ORFeome > chfr – XORFeome 2.0

chfr – XORFeome 2.0

General Information

Species: Xenopus tropicalis checkpoint with forkhead and ring finger domains, mRNA (cDNA clone MGC:75959 IMAGE:5384094), complete cds
Gene Symbol: chfr
Gene ID: 395009
ORF gb_acc: MG133500
ORF ID: 11024

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC064721

Library Location

Plate ID: GDExt11009
Well Location: F12

EST Sequences

Clone: MGC:75959 IMAGE:5384094
Trimmed Sequence: ATGGATGGCTTAGGGGAGAAGAAGCCCTGGGGGAAGCTAAGTAGATTGTTGGGAGCTGAGACGGAATCCTCATCTGAACTGTTTCTCTACAAAAAGGAATGGACAATAGGCAGAAAGAAAGCTTGTGACCTGTCTTTCCCTGGAAACAAGTTAGTGTCTGGAGAACACTGCAAAATTACAGTGAATGAAGAATCTGGTAGTGTTTCCTTAGAGGACACCAGCACAAATGGCACAGTAATCAACAAGCTGAAAGTGGTAAAGAAGCAGACATACCCCTTGAAAAATGGTGATGTGATCTATGTTGTTTATAGGAAAAATGAGCCAGAACAAAATGTTGCTTACCTATACAAATCCTTAAACCAGGCAGAAGATAGTATGCAGAATCCAGCAGATACCTCAGGTTCAGAGGAAGCTGACACTCAGACTTTGTCATCTCAAGATGATCAGCTGTCATATGAGGAACCTCAGCCGTCCACTTCCACATCCAGTCTCTTCAGCACACCTACTACCTCTGCAAGTGAGCCAGCTTGCACTCTCTTGTATAAGTCCCAGGCATCAGTTCCTGGGGTACAGCTTGAAAGTGGTGAGAAGTCTGGGGAAAGTCTTGAAGGACACAGCTCCACATCGGATGCAACAGCACATGAGAAGGGATCTTTAGGTCCTCCAAAAAAGAGAATGAGAACAGAGGACCTCTGGACGGGCAACAAAAATCTTGTTTCTGCAAGTTGTTCCAAAGGAGCAAGCGATGAAAGCAAGACACCAAGTATGAAGCCAGATAAGATGGAGGAAACGCTCACCTGTATAATCTGTCAGGAATTGCTGCACGACTGTGTCAGTTTGCAGCCATGTATGCACACTTTTTGTGCTGCTTGTTATTCTGGTTGGATGGAACGCTCTTCCCTCTGTCCTACCTGCCGCTGCCCTGTTGAACGTATCTGTAAAAACCATATACTGAACAATTTGGTGGAGGCCTATTTGATCCAGCATCCAGAGAAATGCCGCAGTGAGGAAGACAGGTGTAGTATGGATGCACGGAATAAGATTACACAAGATATGTTGCAGCCAAAGGTACGTCGGTCGTTTTCTGATGAAGAAGGGAGCTCTGAGGATCTGCTGGAGCTTTCTGATGTGGATAGTGAATCTTCTGATATAAGCCAGCCTTATACTGTATGCAGACAGTGCCCTGGATATGTCCGCCACAATATTCAACCCCCACCATATCCTCCACCTTCTGACACAGAGGCTTCACGTACTCAAGGAGATGCCCCTTCTACCTCTACTAACTTTCCTACAGCTACCCAGGAATATGTGTGCCCTTCTCATGGAAGCCACGTGATCTGCACCTGCTGCTTCCAGCCGATGCCAGACCGAAGGGCAGAACGGGAGCACAACTCTCATGTGGCACCTCAGCAATGCACTATATGTTTGGAGCCCTTCTGTCACATGTACTGGGGATGCAACCGGATGGGTTGTTTTGGGTGTTTAGCTCCATTCTGTGAGTTGAATCTGGGAGACAAATGTTTGGATGGAGTTTTAAATAACAATAACTATGAATCTGACATCCTTAAGAATTACCTGGCATCCAGGGGACTCACATGGAAAGATATGCTGAATGAAAGCTTGTCAGCTGCTCAGAGAGGGGTGTTTATGCTTCCTGATTACAGGATAAATGGAACCACTGTACTCTGCTACTTCTGCGGGCTGCGGAACTTTAGAATTCTAACATACCAGTACAGACAAAACATCCCAGCTTCAGAGCTACCAGTGACTGTTACTTCTCGGCCAAATTGCTATTGGGGGCGGAATTGCAGAACTCAGGTTAAAGCTCACCATGCTATGAAATTCAATCACATATGTGAACAAACCCGCTTCAAGAACTGA
Full Trace Sequence: cggagagaaagcggctcgaagtgagccgagatggatggcttaggggagaagaagccctgggggaagctaagtagattgttgggagctgagacggaatcctcatctgaactgtttctctacaaaaaggaatggacaataggcagaaagaaagcttgtgacctgtctttccctggaaacaagttagtgtctggagaacactgcaaaattacagtgaatgaagaatctggtagtgtttccttagaggacaccagcacaaatggcacagtaatcaacaagctgaaagtggtaaagaagcagacataccccttgaaaaatggtgatgtgatctatgttgtttataggaaaaatgagccagaacaaaatgttgcttacctatacaaatccttaaaccaggcagaagatagtatgcagaatccagcagatacctcaggttcagaggaagctgacactcagactttgtcatctcaagatgatcagctgtcatatgaggaacctcagccgtccacttccacatccagtctcttcagcacacctactacctctgcaagtgagccagcttgcactctcttgtataagtcccaggcatcagttcctggggtacagcttgaaagtggtgagaagtctggggaaagtcttgaaggacacagctccacatcggatgcaacagcacatgagaagggatctttaggtcctccaaaaaagagaatgagaacagaggacctctggacgggcaacaaaaatcttgtttctgcaagttgttccaaaggagcaagcgatgaaagcaagacaccaagtatgaagccagataagatggaggaaacgctcacctgtataatctgtcaggaattgctgcacgactgtgtcagtttgcagccatgtatgcacactttttgtgctgcttgttattctggttggatggaacgctcttccctctgtcctacctgccgctgccctgttgaacgtatctgtaaaaaccatatactgaacaatttggtggaggcctatttgatccagcatccagagaaatgccgcagtgaggaagacaggtgtagtatggatgcacggaataagattacacaagatatgttgcagccaaaggtacgtcggtcgttttctgatgaagaagggagctctgaggatctgctggagctttctgatgtggatagtgaatcttctgatataagccagccttatactgtatgcagacagtgccctggatatgtccgccacaatattcaacccccaccatatcctccaccttctgacacagaggcttcacgtactcaaggagatgccccttctacctctactaactttcctacagctacccaggaatatgtgtgcccttctcatggaagccacgtgatctgcacctgctgcttccagccgatgccagaccgaagggcagaacgggagcacaactctcatgtggcacctcagcaatgcactatatgtttggagcccttctgtcacatgtactggggatgcaaccggatgggttgttttgggtgtttagctccattctgtgagttgaatctgggagacaaatgtttggatggagttttaaataacaataactatgaatctgacatccttaagaattacctggcatccaggggactcacatggaaagatatgctgaatgaaagcttgtcagctgctcagagaggggtgtttatgcttcctgattacaggataaatggaaccactgtactctgctacttctgcgggctgcggaactttagaattctaacataccagtacagacaaaacatcccagcttcagagctaccagtgactgttacttctcggccaaattgctattgggggcggaattgcagaactcaggttaaagctcaccatgctatgaaattcaatcacatatgtgaacaaacccgcttcaagaactgataactggcaatgcttgaactatcttgcgcctctttaaagtgggatcaaaacaaagaaactttcccttgggactgtgttttagccttctctctaaagtcatagagagactaccctgctcatcacgatgtccgtgacctcaacgtataaattataaccctccgttctaataactttgttatatagtgggcctttacttgtctttcacctccatagctctcacgtctgcccaaattaatgtgtaagcgtcacatttctgttttataagctgcagcttgtgttaaatatagagggcaccagatgtgcttattccacagttgcatcgggctatgcaaagtgtatggcattaggcccatttttatcagctctcattggagtaactgtagcccattgccagttgtctgtatatgtgtgatgggcaaaatataaactgtttgatatgatttttttggacttttttaattagtaatgtgtttctactttatatatatatatttaccagtgaagaaacatcttcctttaatgttgtgcctatgtcagcagcagccccatgtactaaagcctaagccacactgcctggcagttttcttttttttcatgtctgttctagcttagacccaaagtagtctaaatgcatcctattccttcaaatggcttgttcgcacatgcccatagctggacagctattgctcacataactttctccagagacttactgtaaaatacagagtatcatttggatacccgacaggctgctgactgaatggaagcaatgaaagaggtgctgcttctatcacattcacacttagaatgacactcagtgaaagatttagtaaaaaaaaaaaaaactaaaattcaaattatggttcaaaaacttgaatgtctagtatttattaaggtaaaaaaaaacaaaaactcaaatgtaaaaatttgccattttaaaacttgcgagtttctatagaagtccgtgggagttgtccgaggcaaaggcaaagtatttgcaaactcgattgttttgagtttgtaaaatcgaaaaacctgaggtattcgaacctcaaacctgaggtattttctttaataataaaaaagcgagcattcgatatgtgagttttttcaatctagaaaaacaaacttgaattcactaactggaaaattgataaataagcccattaaacatgcagctatagtatgtaatacacacatccagctgtgtgtggtggtggaaagagttagaatgattgctgctagtattcatgtagaaagtatgtaacatgtatggggaatgctgcagtacagtgataggcaacattgcgtgtgacccctgactgctcatatctgggcacatcacatccatattgtaacatatccttttttgtgcactttgttgtgggtccccaggatggtggctgtgactaagtataaaggttctaatatgttgtaacaatcatcgctggcccataatgttctgtataatttaacatgatgtttgtactttccagtggctacaacttatcatgacattgctgtatgtgttacttggccaatatatgactatttatgctcaatagcctgttggactgtttggcactccagcagagcaagggtaaactacaactctaagaataaaaggtacagttgttagctgcctggcagtgccatgttccaaggttcgatttcaaccagtatggactccccatgcttagggtaagggcacacaggctgacaatatgtacataccatgggcctgcaccctaaaggattgaatctgcctgggtgcaggcacaaccagccaatatcctccaactaacgcaagacttggcatttgtgagggtgaggcctgtgtgaccttacccttaggtttcctcccattaccaaaacatacaggcagattaccctgctcagttaccatagtgaatacatgtgatagggaccttggtcgaagacaaggactgataaattaaatctatctctgtagagcactgcagaatatgttgggctacactaaagattgattcaattaccctataaaataaacttgtaattggagtgcaaacaattggttgtacaggatggtggagcactctgttgtttcaggtttaataatgttacccagaccctgttttgccctagtagtttattgggtaacatcccttatcattctgaggttatatagtgttgcaatggcatgtgttttctaggggtgcagtcattttcagtgcatttcttgaacttcggttaatattatagaagtataacaggtgagaagtggttaaaagaataacaaatgaattaaaagtcatacaataaagggcaaacatttataataacaaatctgacaatatatttgtatttctctgtctcacacgtgcagtggtatcctgcttaggtaatggcacatgtgttggtttctgtgtaattggcaccacattaatggcatccacttgtacaaaccttacctgagcatcgtcactgatgcacaatgcactgcactcaaggcaggcaataagtatagggcttccttgcactagatgtgccaacaaaggtgcacatattgcactatactgaggctcaaatcagtgatgcctaaaggggtgtaaatgtgcagtctgtaccacaacagcacttacaattatgttatctttagcaagccttcttctcttacataggccagcactacgtcctctacaggccatgcttaccttgcatttccctttagcggaagcagattagcagcaaacataagaaatgaactatggtttacaggaccttttctttcatattccgagcatggtatcggccataactgtaactaagaatgttcttcctctttttataacttgtgcttgcagcaaaataaattcttttaagcagtcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDGLGEKKPWGKLSRLLGAETESSSELFLYKKEWTIGRKKACDLSFPGNKLVSGEHCKITVNEESGSVSLEDTSTNGTVINKLKVVKKQTYPLKNGDVIYVVYRKNEPEQNVAYLYKSLNQAEDSMQNPADTSGSEEADTQTLSSQDDQLSYEEPQPSTSTSSLFSTPTTSASEPACTLLYKSQASVPGVQLESGEKSGESLEGHSSTSDATAHEKGSLGPPKKRMRTEDLWTGNKNLVSASCSKGASDESKTPSMKPDKMEETLTCIICQELLHDCVSLQPCMHTFCAACYSGWMERSSLCPTCRCPVERICKNHILNNLVEAYLIQHPEKCRSEEDRCSMDARNKITQDMLQPKVRRSFSDEEGSSEDLLELSDVDSESSDISQPYTVCRQCPGYVRHNIQPPPYPPPSDTEASRTQGDAPSTSTNFPTATQEYVCPSHGSHVICTCCFQPMPDRRAEREHNSHVAPQQCTICLEPFCHMYWGCNRMGCFGCLAPFCELNLGDKCLDGVLNNNNYESDILKNYLASRGLTWKDMLNESLSAAQRGVFMLPDYRINGTTVLCYFCGLRNFRILTYQYRQNIPASELPVTVTSRPNCYWGRNCRTQVKAHHAMKFNHICEQTRFKN
Donor tissue: neurula