ORFeome > chit1 – XORFeome 2.0

chit1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis chitinase 1 (chitotriosidase), mRNA (cDNA clone MGC:89015 IMAGE:7004649), complete cds
Gene Symbol: chit1
Gene ID: 448265
ORF gb_acc: MG134141
ORF ID: 11770

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075332

Library Location

Plate ID: GDExt11017
Well Location: A08

EST Sequences

Clone: MGC:89015 IMAGE:7004649
Trimmed Sequence: ATGGGGAAAATGTTGCTTTGGGCGGGTCTGTTCCTGCTGTTGCATTTCCATCATGGATTTGCCTACAAGCTGGTATGCTACTTCACAAACTGGTCACAGTACCGGCCTGAGCCTGCTAAGTACATGCCAGGGAATATTGACCCGAAGCTCTGCACACACCTCATCTATGCCTTTGCCACCATGAACAGCAACAAAATTGCACCCTATGAATGGAATGATGATGTTCTCTACAAACAGTACAATGCCCTGAAACAACAGAATCCAAATTTGGTGACATTATTAGCCATTGGTGGCTGGAACTTTGGGACACAGAAGTTCACAGAGATGGTCTCCAGTGCTGGCAATCGTAAAATATTCATTGACTCTGTGATTGAGTATCTGCGGCTCTATGGGTTTAATGGCATTGACCTAGACTTTGAGTATCCAGGATCTCGAGGCAGTCCACCTGAGGACAAACACAGATTTACCATCCTAACTCAGGAAATGCTAAAGGCGTTTGAGGATGAAGCTGCAGCTACTAATCAATCACGTCTCCTGATGACTGCAGCTGTGTCTGCAGGAAAAGGAACCATTGATGCAGGATATGAGATTGCTGAAATAGGAAAGACCCTGGACTTCATTAGTGTTATGACTTATGATTTTCATGGTGGCTGGGATCCTGTCTCTGGACACAACAGCCCTCTGTGCAAGGGATCCAAGGACACTGGAGACTTTCAGTATTTTAACATTAGATATGCTATGAATTACTGGAAAGATAATGGAGTCCCTGCACAGAAGCTTCTGATAGGGTTCCCTACTTATGGAAGGACATTCAGAAACCCAAATCCTAGCAACTGTGATGTGGGGATCCCTGTATCTGGAGCTGGCTCCGCTGGGCAATACACACGCGAGGCTGGCTTCTGGGCCTACTATGAGATCTGCACATGGCTCAGTGGCACTACAATTAACTGGATTGCAGACCAGAAGGTTCCATACGCCTGCAAGGGAAATGAATGGGTTGGATTCGACAACCAAGATAGTTATGAATGTAAAGTTAAATTCTTGAAGGAAAGTGGCTTTGCTGGTGCTATGGTCTGGGCAATTGATCTGGATGATTTCTCAGGAACTTTCTGCAACCAAGGAAAATATCCTCTTATCAGTCACTTAAAATCCCTCCTTGAAGGCTCTGTCACAAAATGTCCTGGAAATCCTTGTGACATTGTTCCAACAGAACCTCCAAGTCCAACAACTTCTGGAGAAACAACTACTTCCCAAGCAAAGCCAACTCCTGGAGAAACAACTACATCTACAACAACCTCTGGAGATGAGGTTGACCCTAACTTTTGCGCAGGAAAAAGTGACGGACTGTATGAAAATCGTATTAATTTTAACCGTTTTTACATATGCGCTGGAGGAAGCACATACCCGATGAAGTGTGCAGATGGGTTGGTGTTTGATGAAGCATGCAAATGCTGCAACTGGCCAAAGACCTATCTGTAG
Full Trace Sequence: atgaccagagcatcttcagagctgcccaggttccacactgataactgtcaattctgcattataaaggcgcatactgaatttggatcagtgctgagacaaacatagacatggggaaaatgttgctttgggcgggtctgttcctgctgttgcatttccatcatggatttgcctacaagctggtatgctacttcacaaactggtcacagtaccggcctgagcctgctaagtacatgccagggaatattgacccgaagctctgcacacacctcatctatgcctttgccaccatgaacagcaacaaaattgcaccctatgaatggaatgatgatgttctctacaaacagtacaatgccctgaaacaacagaatccaaatttggtgacattattagccattggtggctggaactttgggacacagaagttcacagagatggtctccagtgctggcaatcgtaaaatattcattgactctgtgattgagtatctgcggctctatgggtttaatggcattgacctagactttgagtatccaggatctcgaggcagtccacctgaggacaaacacagatttaccatcctaactcaggaaatgctaaaggcgtttgaggatgaagctgcagctactaatcaatcacgtctcctgatgactgcagctgtgtctgcaggaaaaggaaccattgatgcaggatatgagattgctgaaataggaaagaccctggacttcattagtgttatgacttatgattttcatggtggctgggatcctgtctctggacacaacagccctctgtgcaagggatccaaggacactggagactttcagtattttaacattagatatgctatgaattactggaaagataatggagtccctgcacagaagcttctgatagggttccctacttatggaaggacattcagaaacccaaatcctagcaactgtgatgtggggatccctgtatctggagctggctccgctgggcaatacacacgcgaggctggcttctgggcctactatgagatctgcacatggctcagtggcactacaattaactggattgcagaccagaaggttccatacgcctgcaagggaaatgaatgggttggattcgacaaccaagatagttatgaatgtaaagttaaattcttgaaggaaagtggctttgctggtgctatggtctgggcaattgatctggatgatttctcaggaactttctgcaaccaaggaaaatatcctcttatcagtcacttaaaatccctccttgaaggctctgtcacaaaatgtcctggaaatccttgtgacattgttccaacagaacctccaagtccaacaacttctggagaaacaactacttcccaagcaaagccaactcctggagaaacaactacatctacaacaacctctggagatgaggttgaccctaacttttgcgcaggaaaaagtgacggactgtatgaaaatcgtattaattttaaccgtttttacatatgcgctggaggaagcacatacccgatgaagtgtgcagatgggttggtgtttgatgaagcatgcaaatgctgcaactggccaaagacctatctgtagtagtgtgaaggcagtttaataaacatacaccttcctataaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGKMLLWAGLFLLLHFHHGFAYKLVCYFTNWSQYRPEPAKYMPGNIDPKLCTHLIYAFATMNSNKIAPYEWNDDVLYKQYNALKQQNPNLVTLLAIGGWNFGTQKFTEMVSSAGNRKIFIDSVIEYLRLYGFNGIDLDFEYPGSRGSPPEDKHRFTILTQEMLKAFEDEAAATNQSRLLMTAAVSAGKGTIDAGYEIAEIGKTLDFISVMTYDFHGGWDPVSGHNSPLCKGSKDTGDFQYFNIRYAMNYWKDNGVPAQKLLIGFPTYGRTFRNPNPSNCDVGIPVSGAGSAGQYTREAGFWAYYEICTWLSGTTINWIADQKVPYACKGNEWVGFDNQDSYECKVKFLKESGFAGAMVWAIDLDDFSGTFCNQGKYPLISHLKSLLEGSVTKCPGNPCDIVPTEPPSPTTSGETTTSQAKPTPGETTTSTTTSGDEVDPNFCAGKSDGLYENRINFNRFYICAGGSTYPMKCADGLVFDEACKCCNWPKTYL
Donor tissue: