ORFeome > ckmt1b – XORFeome 2.0

ckmt1b – XORFeome 2.0

General Information

Species: Xenopus tropicalis creatine kinase, mitochondrial 1B, mRNA (cDNA clone MGC:76150 IMAGE:5335280), complete cds
Gene Symbol: ckmt1b
Gene ID: 395000
ORF gb_acc: MG132696
ORF ID: 9987

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064224

Library Location

Plate ID: GDExt11001
Well Location: H02

EST Sequences

Clone: MGC:76150 IMAGE:5335280
Trimmed Sequence: ATGGCCAGTACTTTCACCAGAATCCTGTCCTCAAGGAAATCAGCTGGACTCCTGGCAATGGTTGGAGCAGGTTCTGTAGCAGCTGGATACCTAATGACCAGAGAAGCAATCAGTGCCGACACCAGCAATAGGAGGCTTTACCCAGCAAGTGCAGAGTATCCTGATCTGCGCAAGCACAACAACTGTATGGCAAGCAATCTTACTCCTGCCATCTACACCAAACTCTGCGACAAGAAGACACCTGCAGGTTTCACGGTGGACCAATGCATCCAGACTGGGGTGGATAACCCAGGGCATCCCTTTATTAAGACAGTAGGGATGGTAGCAGGAGATGAAGAATGCTATGAGGTGTTTGCAGATCTGTTTGACCCTGTTATAAAGGAACGCCACAATGGCTATGACCCACGAACCATGAAGCACCCCACAGACTTAGATGCAAGCAAGATCAAAGGTGGCTTCTTTGACGAACGCTATGTGCTTTCCTCTCGTGTCCGTACTGGCCGAAGCATCCGCGGTCTGAGCCTGCCCCCAGCTTGCACCCGAGCAGAGAGAAGGGAAGTGGAAAAGGTGACAGCAGATGCCCTTAATGGACTCCAGGGAGACTTATCTGGACACTACTACAGCCTGACGCAAATGACAGAAAAGCAACAGCAGCAGCTTATTGATGACCACTTCCTCTTTGACAAACCTGTATCCCCATTGCTGACAGCAGCTGGAATGGCGCGGGACTGGCCTGATGCTAGAGGAATATGGCACAACAATGAGAAGACCTTCCTCATCTGGATTAATGAAGAGGACCACACAAGGGTCATCTCTATGGAAAAGGGGGGAAATATGAAGAGGGTCTTTGAGCGGTTCTGTCGGGGCCTGAAGGAGGTTGAGAGACTGATTCAAGAAAAAGGCTGGGAGTTCATGTGGAATGAGCGACTGGGTTATATCCTAACTTGTCCATCCAACTTGGGCACAGGCCTGAGAGCCGGAGTGCACATTAAACTACCTCTCCTGAGCAAGGATGCTCGTTTTGCAAAGATACTGGAAAACCTCCGTCTTCAGAAGAGAGGCACAGGAGGAGTTGACACTGCTGCTGTTGGAAGCACATTCGATATCTCTAACTTGGATCGTTTAGGAAAATCTGAGGTGGAGCTGACGCAGATGGTTATTGATGGAGTCAATTACCTTATTGACTGTGAGAAGCGTCTAGAGAAAGGGCAAGATATCCGCATTCCTTCCCCCGTGGCCCAGTTCAAACACTAA
Full Trace Sequence: ccaggacaagtcagcacacacagagcttcaggatccccaaaatggccagtactttcaccagaatcctgtcctcaaggaaatcagctggactcctggcaatggttggagcaggttctgtagcagctggatacctaatgaccagagaagcaatcagtgccgacaccagcaataggaggctttacccagcaagtgcagagtatcctgatctgcgcaagcacaacaactgtatggcaagcaatcttactcctgccatctacaccaaactctgcgacaagaagacacctgcaggtttcacggtggaccaatgcatccagactggggtggataacccagggcatccctttattaagacagtagggatggtagcaggagatgaagaatgctatgaggtgtttgcagatctgtttgaccctgttataaaggaacgccacaatggctatgacccacgaaccatgaagcaccccacagacttagatgcaagcaagatcaaaggtggcttctttgacgaacgctatgtgctttcctctcgtgtccgtactggccgaagcatccgcggtctgagcctgcccccagcttgcacccgagcagagagaagggaagtggaaaaggtgacagcagatgcccttaatggactccagggagacttatctggacactactacagcctgacgcaaatgacagaaaagcaacagcagcagcttattgatgaccacttcctctttgacaaacctgtatccccattgctgacagcagctggaatggcgcgggactggcctgatgctagaggaatatggcacaacaatgagaagaccttcctcatctggattaatgaagaggaccacacaagggtcatctctatggaaaaggggggaaatatgaagagggtctttgagcggttctgtcggggcctgaaggaggttgagagactgattcaagaaaaaggctgggagttcatgtggaatgagcgactgggttatatcctaacttgtccatccaacttgggcacaggcctgagagccggagtgcacattaaactacctctcctgagcaaggatgctcgttttgcaaagatactggaaaacctccgtcttcagaagagaggcacaggaggagttgacactgctgctgttggaagcacattcgatatctctaacttggatcgtttaggaaaatctgaggtggagctgacgcagatggttattgatggagtcaattaccttattgactgtgagaagcgtctagagaaagggcaagatatccgcattccttcccccgtggcccagttcaaacactaatgtaaagccataaactttgacaccaaatgccatggccccttttcagaatggaagtgggataaatcaaaatcactggatatgccccactggatatggtgggcagcttgctatacacatgcgccctaaatattgtacagcagttgcagcatggtgtgaatatctataaatacattattatatataaacattgtcctgcttccatttcaataaacaacactgctggcaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASTFTRILSSRKSAGLLAMVGAGSVAAGYLMTREAISADTSNRRLYPASAEYPDLRKHNNCMASNLTPAIYTKLCDKKTPAGFTVDQCIQTGVDNPGHPFIKTVGMVAGDEECYEVFADLFDPVIKERHNGYDPRTMKHPTDLDASKIKGGFFDERYVLSSRVRTGRSIRGLSLPPACTRAERREVEKVTADALNGLQGDLSGHYYSLTQMTEKQQQQLIDDHFLFDKPVSPLLTAAGMARDWPDARGIWHNNEKTFLIWINEEDHTRVISMEKGGNMKRVFERFCRGLKEVERLIQEKGWEFMWNERLGYILTCPSNLGTGLRAGVHIKLPLLSKDARFAKILENLRLQKRGTGGVDTAAVGSTFDISNLDRLGKSEVELTQMVIDGVNYLIDCEKRLEKGQDIRIPSPVAQFKH
Donor tissue: tailbud