ORFeome > clk2 – XORFeome 2.0

clk2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis CDC-like kinase 2, mRNA (cDNA clone MGC:97637 IMAGE:6979877), complete cds
Gene Symbol: clk2
Gene ID: 496828
ORF gb_acc: MG134438
ORF ID: 12138

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088525

Library Location

Plate ID: GDExt11021
Well Location: A02

EST Sequences

Clone: MGC:97637 IMAGE:6979877
Trimmed Sequence: ATGCCGCACTCCAGGCGGTACCGTTCTTCAGAGAGGGGCAGCAGGGGCAGTTACCATGAGCGTTACAGAAGCCGAAAGCACAGGCGGAGAAGAAGCAGGTCACGGAGCAGTAGCAGCGACAGAGGACGTGACCGCAGGCACAAGCACGGTGACAGTTACCACGAGAGGTCACGCAGTTACGAGGAGCGCTCGTCGAACAGAAGAGCTTACGATCGGCGGTACTGCGACGGCTACAGGAGGAATGAGTACAGCAGGGACAGGGGGGACGTGTATTACGAGGCAGACTATCGCCACTCGTACGAGTACAAGCACTCGCGGGAGGACAGCTACAGGAGCTGCAAGAGCGCTCGGCGCAAACAGAAGCGGAGAAAGCGCAGAACCAGGTCTTATAGCCAGTCCTCATCGCGGAGTCGCCAGAGCAGCCGGCGGGCCAAGAGTGTTGAAGACGACGTGGAGGGCCACCTGATCTATCACAGCGGCGACTGGCTACAAGAACGATATGAGATTGTGAGCACCCTCGGGGAAGGGACTTTCGGCCGAGTCGTTCAGTGCGTCGATCACAGGAGGGGGGGAGCCAGAGTAGCATTAAAAATCATCAAAAATGTGGAGAAATACAAAGAGGCGGCTCGACTGGAGATCAACGTATTGGAAAAAATCAACGAAAAGGATCCGGAGAACAAACACCTGTGCGTGCAGATGTACGATTGGTTCGACTATCATGGACACATGTGCATCTCATTCGAGCTGCTCGGCCTCAGCACGTTCGACTTCCTGAAAGAGAATAACTACTTCCCGTACCCCATCCACCAAGTGCGGCATATGGCCCTGCAGGTGTGCCAGGCTGTGAAATTTCTGCACGACAACAAACTGACCCATACAGACCTCAAGCCAGAAAATATCTTATTCGTCAGTTCTGACTATGAGCTTACGTACAACATGGAGAAGCGCGACGAGCGGTGCGTCAAGAACACTGACATCAGGGTGGTGGACTTTGGCAGCGCCACGTTTGATCACGAGCATCACAGCACCATCGTCTCCACGCGGCACTACCGGGCGCCCGAGGTTATACTGGAGCTGGGCTGGAACCAACCGTGTGACGTGTGGAGCGTGGGGTGCATTATATTCGAGTACTACGTGGGCTTCACCCTCTTTCAGACCCACGATAACCGAGAGCATTTAGCCATGATGGAGAGGATTCTGGGGCCCGTCCCATCGCGCATGGTTAGGAAAACCAGGAAGCAGAAGTATTTCTACCACGGGCGCCTAGACTGGGATGATAACACGTCCGCGGGCCGATACGTCCGAGAGAACTGCAAGCCCCTAAGGAGGTACATGATGATGGAGACAGAAGAGCACCACCAGCTGTTCAGCCTGATCGAGGGCATGTTGGAATACGAGCCCTCCAAGCGAATGACCCTGGCCGCGGCCCTCAAGCACCCCTTCTTCAGCCCGTTTAAGGGCGAGCCGGCACTTAAGCACTGGGACACTGGCCGGGACATCAGCCGATGA
Full Trace Sequence: gaggcggctgtgagggtagtagcggcgggcagtagcccggacacacgcaccgcaatcacggactttctgtgggacaagagaacgggcctggctgcgagagcgatgccgcactccaggcggtaccgttcttcagagaggggcagcaggggcagttaccatgagcgttacagaagccgaaagcacaggcggagaagaagcaggtcacggagcagtagcagcgacagaggacgtgaccgcaggcacaagcacggtgacagttaccacgagaggtcacgcagttacgaggagcgctcgtcgaacagaagagcttacgatcggcggtactgcgacggctacaggaggaatgagtacagcagggacaggggggacgtgtattacgaggcagactatcgccactcgtacgagtacaagcactcgcgggaggacagctacaggagctgcaagagcgctcggcgcaaacagaagcggagaaagcgcagaaccaggtcttatagccagtcctcatcgcggagtcgccagagcagccggcgggccaagagtgttgaagacgacgtggagggccacctgatctatcacagcggcgactggctacaagaacgatatgagattgtgagcaccctcggggaagggactttcggccgagtcgttcagtgcgtcgatcacaggagggggggagccagagtagcattaaaaatcatcaaaaatgtggagaaatacaaagaggcggctcgactggagatcaacgtattggaaaaaatcaacgaaaaggatccggagaacaaacacctgtgcgtgcagatgtacgattggttcgactatcatggacacatgtgcatctcattcgagctgctcggcctcagcacgttcgacttcctgaaagagaataactacttcccgtaccccatccaccaagtgcggcatatggccctgcaggtgtgccaggctgtgaaatttctgcacgacaacaaactgacccatacagacctcaagccagaaaatatcttattcgtcagttctgactatgagcttacgtacaacatggagaagcgcgacgagcggtgcgtcaagaacactgacatcagggtggtggactttggcagcgccacgtttgatcacgagcatcacagcaccatcgtctccacgcggcactaccgggcgcccgaggttatactggagctgggctggaaccaaccgtgtgacgtgtggagcgtggggtgcattatattcgagtactacgtgggcttcaccctctttcagacccacgataaccgagagcatttagccatgatggagaggattctggggcccgtcccatcgcgcatggttaggaaaaccaggaagcagaagtatttctaccacgggcgcctagactgggatgataacacgtccgcgggccgatacgtccgagagaactgcaagcccctaaggaggtacatgatgatggagacagaagagcaccaccagctgttcagcctgatcgagggcatgttggaatacgagccctccaagcgaatgaccctggccgcggccctcaagcaccccttcttcagcccgtttaagggcgagccggcacttaagcactgggacactggccgggacatcagccgatgatgcccgcacactgcctgcaccgcgggacggcccattggccgagaaagcactgctgccggcgctgccgccccatgaattggcagccggaacctacggtgcttcttccttttctacctgaatgaactgaaacctttcttacatgtaaagctgttaatatgtgagataccctaaatatatgcctatataaatatatatatatattctgtacatgccacggcagcaccctgcacaggctgtcctgtaaataatacccgcctgtaactgcccctgcccggggtcgctgcgggggctgagctgcccccaattcataatttatgtcagtgttaggggagggggcagcaagctggtcagatgtggtgcccgcgggcatcgtcctgtttttataagcttttgtacagtctttgtgagaaataaactctacatgtttgtaaaaaaaaaaaaaaaaa
Translation: MPHSRRYRSSERGSRGSYHERYRSRKHRRRRSRSRSSSSDRGRDRRHKHGDSYHERSRSYEERSSNRRAYDRRYCDGYRRNEYSRDRGDVYYEADYRHSYEYKHSREDSYRSCKSARRKQKRRKRRTRSYSQSSSRSRQSSRRAKSVEDDVEGHLIYHSGDWLQERYEIVSTLGEGTFGRVVQCVDHRRGGARVALKIIKNVEKYKEAARLEINVLEKINEKDPENKHLCVQMYDWFDYHGHMCISFELLGLSTFDFLKENNYFPYPIHQVRHMALQVCQAVKFLHDNKLTHTDLKPENILFVSSDYELTYNMEKRDERCVKNTDIRVVDFGSATFDHEHHSTIVSTRHYRAPEVILELGWNQPCDVWSVGCIIFEYYVGFTLFQTHDNREHLAMMERILGPVPSRMVRKTRKQKYFYHGRLDWDDNTSAGRYVRENCKPLRRYMMMETEEHHQLFSLIEGMLEYEPSKRMTLAAALKHPFFSPFKGEPALKHWDTGRDISR
Donor tissue: tailbud