ORFeome > clk3 – XORFeome 2.0

clk3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis CDC-like kinase 3, mRNA (cDNA clone MGC:97791 IMAGE:6990221), complete cds
Gene Symbol: clk3
Gene ID: 496952
ORF gb_acc: MG134558
ORF ID: 12274

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088580

Library Location

Plate ID: GDExt11022
Well Location: F05

EST Sequences

Clone: MGC:97791 IMAGE:6990221
Trimmed Sequence: ATGCACAGAAGAAAGAGGTATTGGTCACCTAAAGAAGGGGACATAGTCCAAACATGGAAGAGGAGGAGGCGATCCCCAAGCAGAGAGCGAGATGGCCGCCGACTACATACACACAGAATATCCCCACGTGCACACAGATTTTCTCCGTATAGGTCTTGCTTAAGAAGCTGGAAAAGGGACACATTCTTTGATCGGTGCAAGAGGACGCACTCTAGTGAAATTCGTTTTTCTCAAGGGCACAGTACTTCATCCCACAGCAAAAGCTATTCCTACTCCACCCGGTCTCCAGCTCGCCCACACTCAAGAGACCGTACAAAGACAAAAGCTGAGAAACAGCCTCATAAGATCTCTCACAAACACAGCACTAGGTCTGGTAGCTACTCTTCCTCGAAGAGCCAGCGGAGCACTAAGGACAGCCAGAATGTGGAGAATGATAAGGAAGGGCACCTGGTGTGCCGGACGGGAGAACGCATCCAGGAGAGATATGAGATTGTTGGAGACCTAGGAAAAGGGACCTTTGGCAAAGTGGTGGAGTGTCTGGATCTTGCCAGAGGCAACTCCCGAGTAGCTCTCAAGATCATCCGGAATGTGAGGAAATACCGGGAGGCAGCGCAGCTGGAAATAAATGTCTTGGAGAAAATCAAAGAGCGAGATCAGGACAACAAAAATATGTGTGTCTTGATGAGGGACTGGTTTGATTTCCATGGACATGTCTGCATTGCCTTTGAGTTGCTGGGGAAAAGCACTTTTGAGTTCCAGAAAGAGAATAATTTCTTACCGTATCCTCTGGCACATATTCGGCACATGGCCTTCCAGTTGTGCCAAGCATTAAAGTTTTTGCATGAGAATCAGCTGACGCATACTGACCTCAAACCTGAGAACATTCTCTTTGTGAATTCAGAATATGACATCTGCTATAATGAGAGCAAGAAGTGTGAAGAAAAATGCGTGAAAAATCCCAGTATCCGTATAGTAGACTTTGGCAGTGCCACTTTTGACCACGAATACCATACCACTATTGTGGCCACACGCCACTACCGTCCACCAGAAGTGATACTTGAACTGGGCTGGTCCCAACCATGTGATGTGTGGAGCTTGGGCTGCATCCTATTTGAATACTACACTGGATTCACCCTTTTTCAGACCCATGATAACCGGGAGCATTTAGTAATGATGGAGAAGATCCTTGGACCACTACCACGCCGCATGGTGTATAAAACTCGGAAACAAAAGTACTTCCACAATGGCTCCTTGATCTGGGATGAAAATTCTTCAGATGGTCGATATGTCAGCAAAAACTGTCATCAACTTATGAGTTACAAGAGCAGTGATTCTGCGGAACACGTGCAGCTGTTTGACTTGCTGAGCAGGATGCTGGAGTTCAGACCTGCGCTGCGCATCACGCTTCAGGAAGCCCTGGAACATCAATTTTTCACTTGCTTGAAGCCAGAAGAGAATGCTCTGGGTAACCGAATCTCAAGAGACCTCAGCAGATGA
Full Trace Sequence: acgacttcctggaaggttttccatgcgagcgtcagttttatgtgatgcacagaagaaagaggtattggtcacctaaagaaggggacatagtccaaacatggaagaggaggaggcgatccccaagcagagagcgagatggccgccgactacatacacacagaatatccccacgtgcacacagattttctccgtataggtcttgcttaagaagctggaaaagggacacattctttgatcggtgcaagaggacgcactctagtgaaattcgtttttctcaagggcacagtacttcatcccacagcaaaagctattcctactccacccggtctccagctcgcccacactcaagagaccgtacaaagacaaaagctgagaaacagcctcataagatctctcacaaacacagcactaggtctggtagctactcttcctcgaagagccagcggagcactaaggacagccagaatgtggagaatgataaggaagggcacctggtgtgccggacgggagaacgcatccaggagagatatgagattgttggagacctaggaaaagggacctttggcaaagtggtggagtgtctggatcttgccagaggcaactcccgagtagctctcaagatcatccggaatgtgaggaaataccgggaggcagcgcagctggaaataaatgtcttggagaaaatcaaagagcgagatcaggacaacaaaaatatgtgtgtcttgatgagggactggtttgatttccatggacatgtctgcattgcctttgagttgctggggaaaagcacttttgagttccagaaagagaataatttcttaccgtatcctctggcacatattcggcacatggccttccagttgtgccaagcattaaagtttttgcatgagaatcagctgacgcatactgacctcaaacctgagaacattctctttgtgaattcagaatatgacatctgctataatgagagcaagaagtgtgaagaaaaatgcgtgaaaaatcccagtatccgtatagtagactttggcagtgccacttttgaccacgaataccataccactattgtggccacacgccactaccgtccaccagaagtgatacttgaactgggctggtcccaaccatgtgatgtgtggagcttgggctgcatcctatttgaatactacactggattcaccctttttcagacccatgataaccgggagcatttagtaatgatggagaagatccttggaccactaccacgccgcatggtgtataaaactcggaaacaaaagtacttccacaatggctccttgatctgggatgaaaattcttcagatggtcgatatgtcagcaaaaactgtcatcaacttatgagttacaagagcagtgattctgcggaacacgtgcagctgtttgacttgctgagcaggatgctggagttcagacctgcgctgcgcatcacgcttcaggaagccctggaacatcaatttttcacttgcttgaagccagaagagaatgctctgggtaaccgaatctcaagagacctcagcagatgacacgaacagagtttgactggacactttagcgagtatattgctgtcattcggactgattgtatcatcactgtggcacgcttcttgctctgaacatatttcccaatatatctgtaatattgttttctttgtttaagaggaccagtgctacacacacatgcacaatttagtcaacagcaatcaaggatagaagttgcacacttcaagcgtttgtcaatttgcttgattatggtgcaagagccattaagaacaatgtgatctctctgcgtacctgtgatcatggtggatacttatagttcatcgtctgagtcctactgtcagttttagtgcagagcattgtgggaagctgcagccatgtaacacaaatgttgcttttctatttattagaggtgaatagttcatacaaatgtatatatgggtgcactcagggaggtagagcactgagcaagtactcagctgaatttcagtggggaaggaggtgcaaggtctaaaccagaatattacaaagcacacttccctcttactggtgtgccacttatattatagggaggatcttaatagtttccctgtctttgttactgaaagtttgttctatcaataaatttgtgaaggtgatttgttttcataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MHRRKRYWSPKEGDIVQTWKRRRRSPSRERDGRRLHTHRISPRAHRFSPYRSCLRSWKRDTFFDRCKRTHSSEIRFSQGHSTSSHSKSYSYSTRSPARPHSRDRTKTKAEKQPHKISHKHSTRSGSYSSSKSQRSTKDSQNVENDKEGHLVCRTGERIQERYEIVGDLGKGTFGKVVECLDLARGNSRVALKIIRNVRKYREAAQLEINVLEKIKERDQDNKNMCVLMRDWFDFHGHVCIAFELLGKSTFEFQKENNFLPYPLAHIRHMAFQLCQALKFLHENQLTHTDLKPENILFVNSEYDICYNESKKCEEKCVKNPSIRIVDFGSATFDHEYHTTIVATRHYRPPEVILELGWSQPCDVWSLGCILFEYYTGFTLFQTHDNREHLVMMEKILGPLPRRMVYKTRKQKYFHNGSLIWDENSSDGRYVSKNCHQLMSYKSSDSAEHVQLFDLLSRMLEFRPALRITLQEALEHQFFTCLKPEENALGNRISRDLSR
Donor tissue: gastrula