ORFeome > cndp2 – XORFeome 2.0

cndp2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis CNDP dipeptidase 2 (metallopeptidase M20 family), mRNA (cDNA clone MGC:75655 IMAGE:5379710), complete cds
Gene Symbol: cndp2
Gene ID: 394907
ORF gb_acc: MG132846
ORF ID: 10198

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064175

Library Location

Plate ID: GDExt11003
Well Location: B03

EST Sequences

Clone: MGC:75655 IMAGE:5379710
Trimmed Sequence: ATGTCTGTTCTGCAAACCCTGTTTGAGTACATCGATAAGAACCAGGATCTCTATGTTAAGAGACTGGCAGAATGGGTAGCAATCCAGAGTGTTTCAGCCTGGCCAGAGAAAAGAGGTGAAATCAAAAGGATGATGGAGGTAGCTGCAAAGGAGATTGAGCGTCTTGGTGGTACAACTGAACTGGCAGACATTGGAAAACAAAAGCTACCTGATGGCACAGAGATCCCGCTGCCTCCCATTCTCCTTGGCAAACTAGGTTCAGATCCTGGAAAGAAGACAGTTTGTGTATATGGCCACCTGGATGTCCAGCCAGCCGCTCTGGAAGACGGGTGGGACAGCGAACCCTTTGTTTTGGAGGAAAGAGATGGCAAGCTGTATGGAAGAGGCTCTACAGATGATAAAGGCCCTGTGCTTGCATGGTTAAACAGCATAGAAGCTTATCAGAAAACAAACCAGGATCTCCCTGTCAATCTCAAGTTCTGCTTTGAAGGAATGGAAGAGTCTGGATCAGAAGGCTTAGATGACCTTATATTTGCACGGAAGGATACTTTTTTCAAGGGTGTGGACTATGTTTGCATTTCAGACAACTACTGGCTAGGAAAAACTAAGCCCTGTATCACTTATGGTCTCCGTGGCATCTGCTATTTTTTTATCGAGGTGGAATGCAGCTGCAAAGATCTTCACTCTGGGGTATATGGAGGCTCTGTGCATGAGGCAATGACCGATCTCATTGCACTTATGGGGAGCTTAGTAGACAAAAAGGGAAAGATCCTAATCCCTGGTATTAATGAGGCAGTGGCACCTGTTCTGAAGGAAGAGAAAGATATTTATGAAGCAATAGAGTTTGATCTAGAAGACTTTGCAAATGATATTGGAGCTGGGAGACTTCTTCATGAATCAAAGGAAAAGATTCTGATGCACAGGTGGAGATTTCCATCCCTCTCTCTCCATGGCATTGAGGGAGCCTTCTCTGCAACCGGTGCAAAAACAGTAATCCCAAGAAAAGTGATCGGAAAATTTTCCATAAGGCTGGTGCCCGATATGAACCCAGACGATGTGCAAAAACAGGTGGAAGACTATTTGACCAAGAAGTTTAAAGAGCTGGGAAGTCCAAACAAGTTCCAAGTAACAATGGGCCATGGAGGAAAGCCCTGGGTATCTGACTTTAATCACCCTCATTATGTTGCTGGCAGAAAAGCAATGAAAACAGTTTTCAACGTTGAACCCGATCTAACAAGAGAAGGTGGGAGCATTCCTGTAACTCTCACCTTTCAGGAGGCCACTGGCAAGAATGTTATGCTGCTACCTGTAGGCTCTGCAGATGATGGTGCCCACTCTCAGAATGAAAAGCTGAACAGGTCCAATTACATTCAGGGAGTTAAGCTTCTGGGTGCTTACCTGTATGAAGTCTCCAACCTGGAATAA
Full Trace Sequence: gcaagccgatgtgtcagagaaagcgcatttccagcctgactttttcaacagagtgaagccttttcgtgcccctcaatatgtctgttctgcaaaccctgtttgagtacatcgataagaaccaggatctctatgttaagagactggcagaatgggtagcaatccagagtgtttcagcctggccagagaaaagaggtgaaatcaaaaggatgatggaggtagctgcaaaggagattgagcgtcttggtggtacaactgaactggcagacattggaaaacaaaagctacctgatggcacagagatcccgctgcctcccattctccttggcaaactaggttcagatcctggaaagaagacagtttgtgtatatggccacctggatgtccagccagccgctctggaagacgggtgggacagcgaaccctttgttttggaggaaagagatggcaagctgtatggaagaggctctacagatgataaaggccctgtgcttgcatggttaaacagcatagaagcttatcagaaaacaaaccaggatctccctgtcaatctcaagttctgctttgaaggaatggaagagtctggatcagaaggcttagatgaccttatatttgcacggaaggatacttttttcaagggtgtggactatgtttgcatttcagacaactactggctaggaaaaactaagccctgtatcacttatggtctccgtggcatctgctatttttttatcgaggtggaatgcagctgcaaagatcttcactctggggtatatggaggctctgtgcatgaggcaatgaccgatctcattgcacttatggggagcttagtagacaaaaagggaaagatcctaatccctggtattaatgaggcagtggcacctgttctgaaggaagagaaagatatttatgaagcaatagagtttgatctagaagactttgcaaatgatattggagctgggagacttcttcatgaatcaaaggaaaagattctgatgcacaggtggagatttccatccctctctctccatggcattgagggagccttctctgcaaccggtgcaaaaacagtaatcccaagaaaagtgatcggaaaattttccataaggctggtgcccgatatgaacccagacgatgtgcaaaaacaggtggaagactatttgaccaagaagtttaaagagctgggaagtccaaacaagttccaagtaacaatgggccatggaggaaagccctgggtatctgactttaatcaccctcattatgttgctggcagaaaagcaatgaaaacagttttcaacgttgaacccgatctaacaagagaaggtgggagcattcctgtaactctcacctttcaggaggccactggcaagaatgttatgctgctacctgtaggctctgcagatgatggtgcccactctcagaatgaaaagctgaacaggtccaattacattcagggagttaagcttctgggtgcttacctgtatgaagtctccaacctggaataattctgctaactgcatccaatagacataccatccaattccaatacaagtcaacagaagaccatttttatatactgtatactgggaaatgcaattaaacagacctgaatgacaaaaaaaaaaaaaaaaa
Translation: MSVLQTLFEYIDKNQDLYVKRLAEWVAIQSVSAWPEKRGEIKRMMEVAAKEIERLGGTTELADIGKQKLPDGTEIPLPPILLGKLGSDPGKKTVCVYGHLDVQPAALEDGWDSEPFVLEERDGKLYGRGSTDDKGPVLAWLNSIEAYQKTNQDLPVNLKFCFEGMEESGSEGLDDLIFARKDTFFKGVDYVCISDNYWLGKTKPCITYGLRGICYFFIEVECSCKDLHSGVYGGSVHEAMTDLIALMGSLVDKKGKILIPGINEAVAPVLKEEKDIYEAIEFDLEDFANDIGAGRLLHESKEKILMHRWRFPSLSLHGIEGAFSATGAKTVIPRKVIGKFSIRLVPDMNPDDVQKQVEDYLTKKFKELGSPNKFQVTMGHGGKPWVSDFNHPHYVAGRKAMKTVFNVEPDLTREGGSIPVTLTFQEATGKNVMLLPVGSADDGAHSQNEKLNRSNYIQGVKLLGAYLYEVSNLE
Donor tissue: tailbud