ORFeome > col4a3bp – XORFeome 2.0

col4a3bp – XORFeome 2.0

General Information

Species: Xenopus tropicalis collagen, type IV, alpha 3 binding protein, mRNA (cDNA clone MGC:75623 IMAGE:5379384), complete cds
Gene Symbol: col4a3bp
Gene ID: 387331
ORF gb_acc: MG132848
ORF ID: 10200

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063901

Library Location

Plate ID: GDExt11003
Well Location: B05

EST Sequences

Clone: MGC:75623 IMAGE:5379384
Trimmed Sequence: ATGTCGGATAATCAGAGCTGGAATTCCTCGGGCTCAGAGGAAGACCTGGAGACTGAGTCCGGGCCGCCGGTTGAGAGGTGCGGTGTCCTGTCTAAGTGGACCAACTATATTCATGGCTGGCAGGATCGATGGGTAGTCTTGAAAAACAACACATTAAGCTACTACAAATCAGAGGATGAGACAGAATATGGCTGCAGGGGATCCATTTGCCTTAGCAAAGCTGTTATCACGCCTCATGAATTTGATGAGTGCCGTTTCGATATCAGTGTTAATGACAGTGTGTGGTATCTCCGTGCTCAAGACCCAGATCATCGGCAAAGATGGATAGATTCAATTGAACAACACAAGTCTGAATCTGGCTATGGATCAGAATCCAGTTTACGGCGGCATGGCTCAATGGTGTCCCTCGTGTCTGGGGCAAGTGGTTACTCTGCCACATCCACGTCATCATTTAAGAAAGGACACAGCCTGCGGGAGAAACTGGCGGAAATGGAGACTTTCCGAGACATCCTATGCAGACAGGTTGACACGCTGCAGAAATATTTTGATGCGTGTGCAGATGCAGTTTCCAAAGATGAGCTTGAAAGGGATAAAGTTGAAGACGATGAAGATGATTTTCTTCATAGCCATCCCAATGGAGATTACATTCATAGCAGTATTGGGAGTAAAGATAAATTATTCCAGCACGTGTCTCCAAAGGGCATTAATGGCATTGACTTTAAAGGAGAAGCCATCACATTTAAAGCTACCACTGCAGGAATATTGGCTACTTTGTCGCACTGCATTGATCTCATGGTGAAGCGGGAGGACAGCTGGCAGAAACGGCTTGATAAGGAAATCGAGAAGAGGAGGCGAGTAGAGGAAGCCTATAAGAATGCAATGACTGAACTCAAAAAGAAATCTCATTTTGGTGGACCAGATTATGAGGAAGGCCCCAACAGCCTGATAAATGAAGAAGAATTCTTTGATGCGGTTGAAGCTGCTCTGGACAGACAAGATAAAATTGAGCAGTCTCAGAGTGAAAAGGGCAGATCACACTGGCCATCTTCTCTTCCTTCAACTGAAGCATACACAACTGCCGGCAGTCACAGATTTGTTCAAGCTCCCCCTAGTTGTCCACCTCCCACTGATCTAGTCAGTTCCTCTGATGAACACAGATTCAGGATCCAGGTCGAAGAAATGGTACAGAACCACATGACTTATTCTCTGCAAGATGTCGGAGGGGATGCCAACTGGCAGCTGGTTGTTGAAGAGGGGGAAATGAAGGTCTATAGGAGAGAAGTGGAAGAGAATGGAATTGTCCTAGATCCCCTGAAAGCTACACATTCTGTGAAAGGGGTGACCGGCCACGAGGTCTGCCAGCACTTCTGGAATGTAGATGTGCGCAATGACTGGGAAACGACCATTGAAAATTTCCATGTTGTTGAAAAGTTATCACCAAATGCAATCATCGTATACCAAACGCACAAGAGAGTTTGGCCTGCTTCCCAGCGTGATGTGTTGTATTTATCTGCTATTCGGATGGTACCAGCTGCCAGCGAGAATGAAATGGACACTTGGATTGTCTGCAACTTCTCAGTTGACCATGACAACGCTCCCCTAAACCGATGTGTTCGTGCCAAAATCAATATTGCGATGATCTGTCAGACTCTGGTTAGCCCACCGGAAGGAAATAAAGAAATCAGCAGAGATAATATTCAGTGCAAAATAACATATGTTGCTAATGTCAATCCAGGAGGATGGGCTCCTGCCTCTGTACTTCGGGCAGTAGCAAAACGGGAGTATCCTAAATTTCTGAAACGCTTTACATCATATGTGCAAGAGAAAACCGCTGGCAAGTCTATTCTTTTCTAG
Full Trace Sequence: ggtttgtgagctcggcggttggtctcctctgtgccgtgcagtcggtgtctatacatccgggtcccttacacgtcgcttttccccacatcgttgggtgtgtgccaggtagagccgtgcgagtgaaagctccttctcctatcccgccggtgccttgccgtgtccccgctcatgtcggataatcagagctggaattcctcgggctcagaggaagacctggagactgagtccgggccgccggttgagaggtgcggtgtcctgtctaagtggaccaactatattcatggctggcaggatcgatgggtagtcttgaaaaacaacacattaagctactacaaatcagaggatgagacagaatatggctgcaggggatccatttgccttagcaaagctgttatcacgcctcatgaatttgatgagtgccgtttcgatatcagtgttaatgacagtgtgtggtatctccgtgctcaagacccagatcatcggcaaagatggatagattcaattgaacaacacaagtctgaatctggctatggatcagaatccagtttacggcggcatggctcaatggtgtccctcgtgtctggggcaagtggttactctgccacatccacgtcatcatttaagaaaggacacagcctgcgggagaaactggcggaaatggagactttccgagacatcctatgcagacaggttgacacgctgcagaaatattttgatgcgtgtgcagatgcagtttccaaagatgagcttgaaagggataaagttgaagacgatgaagatgattttcttcatagccatcccaatggagattacattcatagcagtattgggagtaaagataaattattccagcacgtgtctccaaagggcattaatggcattgactttaaaggagaagccatcacatttaaagctaccactgcaggaatattggctactttgtcgcactgcattgatctcatggtgaagcgggaggacagctggcagaaacggcttgataaggaaatcgagaagaggaggcgagtagaggaagcctataagaatgcaatgactgaactcaaaaagaaatctcattttggtggaccagattatgaggaaggccccaacagcctgataaatgaagaagaattctttgatgcggttgaagctgctctggacagacaagataaaattgagcagtctcagagtgaaaagggcagatcacactggccatcttctcttccttcaactgaagcatacacaactgccggcagtcacagatttgttcaagctccccctagttgtccacctcccactgatctagtcagttcctctgatgaacacagattcaggatccaggtcgaagaaatggtacagaaccacatgacttattctctgcaagatgtcggaggggatgccaactggcagctggttgttgaagagggggaaatgaaggtctataggagagaagtggaagagaatggaattgtcctagatcccctgaaagctacacattctgtgaaaggggtgaccggccacgaggtctgccagcacttctggaatgtagatgtgcgcaatgactgggaaacgaccattgaaaatttccatgttgttgaaaagttatcaccaaatgcaatcatcgtataccaaacgcacaagagagtttggcctgcttcccagcgtgatgtgttgtatttatctgctattcggatggtaccagctgccagcgagaatgaaatggacacttggattgtctgcaacttctcagttgaccatgacaacgctcccctaaaccgatgtgttcgtgccaaaatcaatattgcgatgatctgtcagactctggttagcccaccggaaggaaataaagaaatcagcagagataatattcagtgcaaaataacatatgttgctaatgtcaatccaggaggatgggctcctgcctctgtacttcgggcagtagcaaaacgggagtatcctaaatttctgaaacgctttacatcatatgtgcaagagaaaaccgctggcaagtctattcttttctagctgctgcctgtgaaatgaaggcggtatgaacattccacactggatgggagcgtatcagataacatggaatctacagcctttaccaacttcctacagttaaagcccttccattttagtaggagtttcagtaccctctgctgctctgacgtttagtttcatcattggagggtggagacttacaaaggagtgaacatcaaacactagatagggggttttgttttttattttttaaccccttgtcaccgaatatgtatgtagttctaacgtaatgtacggctacaagtaccgctctgtgtcctttataccccccctgcttgcttgcttttatggctcatgggagaacaagtctcacaaatacaaatgggttgaggctttaacattgttttcttttgtaagtgaaacctgttcatgtacaggccaataataaaaatgactaataaagccataatatttttagttttgtgcatataaagagcaggaccccccaagcgcacactatgctctttctgcacaaaactcgtcagccatttcattaaaaaacaaaggtaactgtttagcagaaagttccttgtttatctttctgtaaaaaaacagaaaagaaatgtttttagctggcttcttgctagttctttccgtggttctgtaagacttctcattaatatctgagggctgttataatctttggctatgcctttcctggtgtctctcctatgaagacgtgacgtctgacggaggaaataaaaaaaaaaaaaaactaagaaagctttattttttccagaaatctatatatttctattgtatttttagttgtgttaataaagtggagaaaaattgtgttctttgacacgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSDNQSWNSSGSEEDLETESGPPVERCGVLSKWTNYIHGWQDRWVVLKNNTLSYYKSEDETEYGCRGSICLSKAVITPHEFDECRFDISVNDSVWYLRAQDPDHRQRWIDSIEQHKSESGYGSESSLRRHGSMVSLVSGASGYSATSTSSFKKGHSLREKLAEMETFRDILCRQVDTLQKYFDACADAVSKDELERDKVEDDEDDFLHSHPNGDYIHSSIGSKDKLFQHVSPKGINGIDFKGEAITFKATTAGILATLSHCIDLMVKREDSWQKRLDKEIEKRRRVEEAYKNAMTELKKKSHFGGPDYEEGPNSLINEEEFFDAVEAALDRQDKIEQSQSEKGRSHWPSSLPSTEAYTTAGSHRFVQAPPSCPPPTDLVSSSDEHRFRIQVEEMVQNHMTYSLQDVGGDANWQLVVEEGEMKVYRREVEENGIVLDPLKATHSVKGVTGHEVCQHFWNVDVRNDWETTIENFHVVEKLSPNAIIVYQTHKRVWPASQRDVLYLSAIRMVPAASENEMDTWIVCNFSVDHDNAPLNRCVRAKINIAMICQTLVSPPEGNKEISRDNIQCKITYVANVNPGGWAPASVLRAVAKREYPKFLKRFTSYVQEKTAGKSILF
Donor tissue: tailbud