ORFeome > copg2 – XORFeome 2.0

copg2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis copg2 protein, mRNA (cDNA clone MGC:79509 IMAGE:6977230), complete cds
Gene Symbol: copg2
Gene ID: 493381
ORF gb_acc:
ORF ID: 11057

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080897

Library Location

Plate ID: GDExt11010
Well Location: F08

EST Sequences

Clone: MGC:79509 IMAGE:6977230
Trimmed Sequence: ATGATCAAGAAATTTGACAAGAAGGACGAGGAATCCGGAATTGGGTCCAATCCTTTCCAGCATTTGGAAAAGAGTGCGGTTCTACAGGAGGCTCGGTTATTCAATGAGACGCCCATCAATCCTAGAAGATGTCTTCATATTTTAACCAAGATTTTGTACTTGCTGAACCAGGGTGAACACTTCGGTACAATGGAAGCCACTGAAGCATTTTTTGCCATGACCCGTTTATTTCAGTCCAACGATCAAACTCTACGGAGGATGTGCTACCTTACTATCAAGGAAATGGCCAATATCTCTGAAGATGTTATTATAGTCACTAGCAGTCTGACTAAGGACATGACTGGCAAAGAAGATGTGTATCGCGGGCCTGCCATCCGAGCACTGTGCAGGATAACTGACGCCACGATGCTTCAAGGGATAGAGCGATATATGAAACAAGCCATCGTAGATAAAGTTTCCAGTGTTTCCAGCTCAGCACTGGTATCTTCCTTGCATATGACAAAAATTAGCTATGACGTAGTAAAACGCTGGATTAATGAGGCTCAAGAAGCAGCATCTAGTGACAACATTATGGTACAGTATCATGCCCTGGGACTCCTCTACAACCTAAGGAAGAATGATCGTCTTGCAGTTTCCAAAATGCTAAACAAATTTACCAAATCTGGTTTGAAATCCCCATTTGCTTACTGCATGCTAATCCGAATAGCTAGCCGACTGCTGGAAGAGTCTGAAGAAGGGCACAACAGCCCTCTGTTCGATTTTATTGAGAGCTGTCTTCGAAACAAACATGAAATGGTAATTTATGAAGCTGCCTCTGCCATTATCCACCTACCTAACTGCACAGCAAGAGAGCTGGCCCCTGCTGTATCAGTCCTGCAGCTTTTCTGTAGTTCTCCCAAACCTGCCCTGAGGTATGCTGCAGTAAGGACACTTAACAAGGTTGCAATGAAACATCCATCTGCAGTTACTGCATGTAACCTAGACCTTGAAAATTTGATCACAGATTCCAACCGCAGTATTGCCACGCTGGCCATCACAACACTGCTGAAAACCGGCAGCGAAAGCAGTGTTGATCGACTAATGAAACAAATCTCCACCTTTGTCTCTGAGATCTCAGATGAGTTTAAAGTGGTAGTTGTACAAGCAATCAGTGCCTTATGTCAGAAGTACCCACGCAAGCACAGCGTAATGATGACGTTCCTTTCCAACATGCTCAGGGATGACGGAGGTTTTGAATACAAGCGTGCCATTGTGGACTGCATTATTAGCATCATAGAAGAGAACCCAGACAGCAAAGAATCTGGCCTTGCTCACCTGTGTGAATTTATTGAGGACTGTGAGCACACAGTTCTGGCTACCAAGATTCTGCATCTTTTGGGAAGAGAAGGGCCAAAAACACCCACACCCTCCAAGTACATTCGTTTCATCTTTAACAGGGTGGTATTAGAGAATGAAGCCGTCAGAGCAGCGGCGGTCAGTGCTTTGGCTAAATTTGGTGCCCAAAACGAACCTCTTCTACCAAGTGTTTTGGTACTTCTTCAAAGGTGCATGATGGACAGTGATGATGAGGTGCGAGACAGAGCAACATTTTACTTCAATGTATTAAACCAAAACCAACTAGCACTTAATACTGCCTACATTTTCAATGGTCTTACAGTTTCTGTTTTTGGAATGGAGAAAGCCCTACACCAATATACACTGGAACCTTCAGAGAAACCCTTTGATATGAAGACTGTTCCTCTTGCCACTGTGCCCTTTTTGGAACAGAAGACTGATCTTGCACCTATTGCTACCAAACAGCCTGAGAAAATGGTACCTGTCAGACAAGACATCTTCCAAGACCAATTAGCTGCCATTCCGGAATTTAAGAACCTGGGGCCCTTGTTTAAGTCTTCCGAGCCCGTGCAGCTTACTGAAGCGGAGACTGAATATTTTGTAAGATGCATCAAGCATGTATTTCCAAATCATATTGTGTTCCAGTTTGATTGCACAAATACACTAAATGATCAGCTCTTAGAGAAGGTGACAGTGCAGATGGAGCCATCAGAAGCTTATGAAGTGGTACATTATGTCCCAGCTCCAAGCCTTCCATATAACCAACCTGGCATTAGTTATACACTTGTCAGGCTTCCCGATGATGATCCTACTGCAGTGTCCTGTACATTCAGTTGCACAATGAAGTTTGTGGTCAGAGATTGTGACCCCCAGACTGGTGTTCCTGATGATGAAGGTTACAGTGATGAATATGTGCTTGAAGACCTAGAGGTGACTCTGTCAGACCATATTCAGAAAATACTGAAGCCAAATTTTGGAGCAGCATGGGAAGAAATTGGTGATACATATGAGAAAGAAGAAACATTTGCCCTTACTACAACAAAGAGCCTAGAAGAGGCTGTTAACAACATAATTAAATTCCTGGGGATGCAGCCATGTGAGAGGTCTGACAAGGTGCCAGAAAACAAGAACTCACACGTGCTATACTTGTCAGGGGTTTACAGAGGAGGTCATGATGTGCTTGTGAGATCCAGACTCGCCCTAGCTGATGGGGTTACCATGCAAGTTACTGTCAGGAGCCAAGATGAAACTCCAGCAAATGTCATTCTGGTCTCAGTGGGCTAA
Full Trace Sequence: gagattggcctctaacgtgcccatctatgaaaatgatcaagaaatttgacaagaaggacgaggaatccgcacgcctcttcctgtgttgcctgacaaccactcactgcccctgagaaggaggggagccggcttgctcacgcagcacgcacagccgggggggtgagaggggtgaaactctgccactgagattggcctctaacgtgcccatctatgaaaatgatcaagaaatttgacaagaaggacgaggaatccggaattgggtccaatcctttccagcatttggaaaagagtgcggttctacaggaggctcggttattcaatgagacgcccatcaatcctagaagatgtcttcatattttaaccaagattttgtacttgctgaaccagggtgaacacttcggtacaatggaagccactgaagcattttttgccatgacccgtttatttcagtccaacgatcaaactctacggaggatgtgctaccttactatcaaggaaatggccaatatctctgaagatgttattatagtcactagcagtctgactaaggacatgactggcaaagaagatgtgtatcgcgggcctgccatccgagcactgtgcaggataactgacgccacgatgcttcaagggatagagcgatatatgaaacaagccatcgtagataaagtttccagtgtttccagctcagcactggtatcttccttgcatatgacaaaaattagctatgacgtagtaaaacgctggattaatgaggctcaagaagcagcatctagtgacaacattatggtacagtatcatgccctgggactcctctacaacctaaggaagaatgatcgtcttgcagtttccaaaatgctaaacaaatttaccaaatctggtttgaaatccccatttgcttactgcatgctaatccgaatagctagccgactgctggaagagtctgaagaagggcacaacagccctctgttcgattttattgagagctgtcttcgaaacaaacatgaaatggtaatttatgaagctgcctctgccattatccacctacctaactgcacagcaagagagctggcccctgctgtatcagtcctgcagcttttctgtagttctcccaaacctgccctgaggtatgctgcagtaaggacacttaacaaggttgcaatgaaacatccatctgcagttactgcatgtaacctagaccttgaaaatttgatcacagattccaaccgcagtattgccacgctggccatcacaacactgctgaaaaccggcagcgaaagcagtgttgatcgactaatgaaacaaatctccacctttgtctctgagatctcagatgagtttaaagtggtagttgtacaagcaatcagtgccttatgtcagaagtacccacgcaagcacagcgtaatgatgacgttcctttccaacatgctcagggatgacggaggttttgaatacaagcgtgccattgtggactgcattattagcatcatagaagagaacccagacagcaaagaatctggccttgctcacctgtgtgaatttattgaggactgtgagcacacagttctggctaccaagattctgcatcttttgggaagagaagggccaaaaacacccacaccctccaagtacattcgtttcatctttaacagggtggtattagagaatgaagccgtcagagcagcggcggtcagtgctttggctaaatttggtgcccaaaacgaacctcttctaccaagtgttttggtacttcttcaaaggtgcatgatggacagtgatgatgaggtgcgagacagagcaacattttacttcaatgtattaaaccaaaaccaactagcacttaatactgcctacattttcaatggtcttacagtttctgtttttggaatggagaaagccctacaccaatatacactggaaccttcagagaaaccctttgatatgaagactgttcctcttgccactgtgccctttttggaacagaagactgatcttgcacctattgctaccaaacagcctgagaaaatggtacctgtcagacaagacatcttccaagaccaattagctgccattccggaatttaagaacctggggcccttgtttaagtcttccgagcccgtgcagcttactgaagcggagactgaatattttgtaagatgcatcaagcatgtatttccaaatcatattgtgttccagtttgattgcacaaatacactaaatgatcagctcttagagaaggtgacagtgcagatggagccatcagaagcttatgaagtggtacattatgtcccagctccaagccttccatataaccaacctggcattagttatacacttgtcaggcttcccgatgatgatcctactgcagtgtcctgtacattcagttgcacaatgaagtttgtggtcagagattgtgacccccagactggtgttcctgatgatgaaggttacagtgatgaatatgtgcttgaagacctagaggtgactctgtcagaccatattcagaaaatactgaagccaaattttggagcagcatgggaagaaattggtgatacatatgagaaagaagaaacatttgcccttactacaacaaagagcctagaagaggctgttaacaacataattaaattcctggggatgcagccatgtgagaggtctgacaaggtgccagaaaacaagaactcacacgtgctatacttgtcaggggtttacagaggaggtcatgatgtgcttgtgagatccagactcgccctagctgatggggttaccatgcaagttactgtcaggagccaagatgaaactccagcaaatgtcattctggtctcagtgggctaagtcattcctttgtcaaagcagaactttctcctgcccactgtacaaacaaacatttcttctacaaacacatttcttctttctgccatctgaagtgtcagaaaatgtcccgaacctttctcttctatgaaaagaacttttgattgggcagcctgcagtagaaatacatagagggctttcttgcagactacgggttgaagttgttgaaagtagaatgtagtccattccaatgtgttgtgttatgttaagcatagaaatacatgtttgcactctgacattcataacaatggtcatatattcataataatggatataagtagagaataatcacattcatttaaattatactactgaccttgctgcattcatttcacaccagactcctgtttatggttctttgcattcgctaaaagtgaaggtcaataagctttaacattaagagtgcaaaaccatgctttccccagtgcattagttactgtattttagcccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MIKKFDKKDEESGIGSNPFQHLEKSAVLQEARLFNETPINPRRCLHILTKILYLLNQGEHFGTMEATEAFFAMTRLFQSNDQTLRRMCYLTIKEMANISEDVIIVTSSLTKDMTGKEDVYRGPAIRALCRITDATMLQGIERYMKQAIVDKVSSVSSSALVSSLHMTKISYDVVKRWINEAQEAASSDNIMVQYHALGLLYNLRKNDRLAVSKMLNKFTKSGLKSPFAYCMLIRIASRLLEESEEGHNSPLFDFIESCLRNKHEMVIYEAASAIIHLPNCTARELAPAVSVLQLFCSSPKPALRYAAVRTLNKVAMKHPSAVTACNLDLENLITDSNRSIATLAITTLLKTGSESSVDRLMKQISTFVSEISDEFKVVVVQAISALCQKYPRKHSVMMTFLSNMLRDDGGFEYKRAIVDCIISIIEENPDSKESGLAHLCEFIEDCEHTVLATKILHLLGREGPKTPTPSKYIRFIFNRVVLENEAVRAAAVSALAKFGAQNEPLLPSVLVLLQRCMMDSDDEVRDRATFYFNVLNQNQLALNTAYIFNGLTVSVFGMEKALHQYTLEPSEKPFDMKTVPLATVPFLEQKTDLAPIATKQPEKMVPVRQDIFQDQLAAIPEFKNLGPLFKSSEPVQLTEAETEYFVRCIKHVFPNHIVFQFDCTNTLNDQLLEKVTVQMEPSEAYEVVHYVPAPSLPYNQPGISYTLVRLPDDDPTAVSCTFSCTMKFVVRDCDPQTGVPDDEGYSDEYVLEDLEVTLSDHIQKILKPNFGAAWEEIGDTYEKEETFALTTTKSLEEAVNNIIKFLGMQPCERSDKVPENKNSHVLYLSGVYRGGHDVLVRSRLALADGVTMQVTVRSQDETPANVILVSVG
Donor tissue: tailbud