ORFeome > crp – XORFeome 2.0

crp – XORFeome 2.0

General Information

Species: Xenopus tropicalis C-reactive protein, pentraxin-related, mRNA (cDNA clone MGC:89191 IMAGE:7016862), complete cds
Gene Symbol: crp
Gene ID: 448345
ORF gb_acc: MG134176
ORF ID: 11814

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075426

Library Location

Plate ID: GDExt11018
Well Location: E02

EST Sequences

Clone: MGC:89191 IMAGE:7016862
Trimmed Sequence: ATGGCCATTGCAATTATTGGCGCGCTCCTTTTTATTATCAGTACTGGGCTCTGTGCCACAGAAGGTAATCAAGATCTTCAAGGAAAATCTCTGAGCTTCGAAAAGCAAACATTTTCTAATTATGCCATCTTACATCCTAAAAAGCCTCTAAACCTGGATGCCTTCACCCTTTGCCTCCGGGTATCTGCTGAGCCCCCAGGAAACCGTGACATGATTCTGTTCTCCTACTTTGGCAAAGGAGCTGATCAACTGAATCTTTGGAGAGAGCGTGATGGCCGTTTCTCATTATACCTTGCAAGCAGTGTAGAAGGTGTTTTCTTCTCTCTACCCCAGATCAGCACATTTGGTACCCAACTCTGTGTAACCTGGGAATCTTCATCTGGTACCACTGCCTTCTGGGTTGATGGTAAAATGTCAGTGAGAAAAACATATCGTCAACACCACAAAGTGCCTGGAGGCGGCACTGTAATACTTGGGCAAGATCAGGATCTCCAAGGGGGAGGATTTGATGCATCGCAAAGCTTTGTGGGTGAAGTCACTAATGTCAATCTGTGGGATTATGTTCTGCCATGTGAATTCACCAGTGAGGCATTTGCTTTGGGGGGAAATGTTATCAACTGGGGGGAGGTTCAATGCAAAATTGTAGGGGAAGTAAAGATGTATGAAAGTGGTGGAAAGTACATAGAAGAGCAAATTGTGGAGTGA
Full Trace Sequence: gtcttgtcctgagccgttcgctaccatggccattgcaattattggcgcgctcctttttattatcagtactgggctctgtgccacagaaggtaatcaagatcttcaaggaaaatctctgagcttcgaaaagcaaacattttctaattatgccatcttacatcctaaaaagcctctaaacctggatgccttcaccctttgcctccgggtatctgctgagcccccaggaaaccgtgacatgattctgttctcctactttggcaaaggagctgatcaactgaatctttggagagagcgtgatggccgtttctcattataccttgcaagcagtgtagaaggtgttttcttctctctaccccagatcagcacatttggtacccaactctgtgtaacctgggaatcttcatctggtaccactgccttctgggttgatggtaaaatgtcagtgagaaaaacatatcgtcaacaccacaaagtgcctggaggcggcactgtaatacttgggcaagatcaggatctccaagggggaggatttgatgcatcgcaaagctttgtgggtgaagtcactaatgtcaatctgtgggattatgttctgccatgtgaattcaccagtgaggcatttgctttggggggaaatgttatcaactggggggaggttcaatgcaaaattgtaggggaagtaaagatgtatgaaagtggtggaaagtacatagaagagcaaattgtggagtgaaccccgacatgcagacagggtgaggcctttattctggagggcaggcaatttctaaatcagcaattccttacctgtaaagcttcagctttcgtggaactatatctcctagttccagcatcccactcacagctttaacaacacctgtaattaattgttaatgtatgtactgaaaacacctaagcattgctatttactataattcaggggtacttagattttactgatgtgatgtggtctacttttagtgatgctgtccaatcaagaacttccatctcaatgacaggattctgttacagtaccatggaaaatatagtttaaatacatacatacattcaactatatgaaaataccattatctttcatgtttttgccactagtattccccttatgcagcagacccaatgctcgctcttccctacaataaacccagcattgctcacagtcttgttttatcataatgctatgtatgatttccttttgtgattgcaatattaatgcggaatgtaattcttttttgatcacccatgttctataatacaataaaaaaggcttatgcttattatcattaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAIAIIGALLFIISTGLCATEGNQDLQGKSLSFEKQTFSNYAILHPKKPLNLDAFTLCLRVSAEPPGNRDMILFSYFGKGADQLNLWRERDGRFSLYLASSVEGVFFSLPQISTFGTQLCVTWESSSGTTAFWVDGKMSVRKTYRQHHKVPGGGTVILGQDQDLQGGGFDASQSFVGEVTNVNLWDYVLPCEFTSEAFALGGNVINWGEVQCKIVGEVKMYESGGKYIEEQIVE
Donor tissue: