ORFeome > ctbp1 – XORFeome 2.0

ctbp1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis C-terminal binding protein 1, mRNA (cDNA clone MGC:79613 IMAGE:6979675), complete cds
Gene Symbol: ctbp1
Gene ID: 493289
ORF gb_acc: MG133606
ORF ID: 11143

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080343

Library Location

Plate ID: GDExt11011
Well Location: H09

EST Sequences

Clone: MGC:79613 IMAGE:6979675
Trimmed Sequence: ATGGGAAGTTCTCACTTGCTAAACAAGGGTTTGCCTCTAGGCATTCGACCTCCAATTATGAACGGGCCCATGCACCCGCGCCCATTGGTAGCATTGCTCGATGGCAGAGATTGCACCGTAGAGATGCCCATTCTGAAGGACGTGGCCACTGTGGCTTTCTGCGATGCACAGTCTACACAAGAAATTCACGAAAAGGTGCTAAATGAAGCGGTGGGAGCCCTGATGTATCATACGATCACGTTAACAAGGGAAGATCTGGAGAAGTTCAAGGCTCTCCGAATAATTGTCCGAATCGGAAGTGGGTTTGACAACATCGATATCAAGTCAGCCGGGGATCTAGGTATTGCAGTATGTAACGTGCCAGCAGCCTCTGTAGAGGAGACAGCGGATTCGACCATGTGCCACATTTTAAACTTATACAGGAGAACGACGTGGCTGCACCAGGCGTTAAGAGAAGGAACCAGGGTGCAGAGCGTAGAGCAGATAAGGGAGGTGGCATCTGGGGCAGCACGGATTCGCGGGGAAACTTTAGGCATTATAGGACTCGGGCGGGTTGGTCAAGCAGTGGCGCTGCGGGCAAAAACCTTTGGTTTCAACGTCTATTTCTATGACCCTTACCTCTCAGACGGCATTGAACGTGCGCTTGGCCTCCAGCGGGTCAGCACCCTACAAGACCTCCTGTTCAATAGCGACTGTGTAACCCTGCACTGCAGTTTAAATGAGCACAACCATCACCTTATTAATGACTTTACCATTAAACAGATGAGGCAGGGTGCCTTCTTAGTGAACACGGCACGAGGTGGCTTGGTGGATGAGAAGGCACTGGCGCAGGCCCTAAAGGAGGGCAGGATACGAGGAGCGGCATTAGATGTACATGAGTCGGAACCTTTCAGCTTCAGCCAGGGTGCTCTTAAAGATGCGCCAAACCTCATCTGTACGCCACACGCGGCTTGGTACAGCGAGCAAGCGTCCATAGAGATGCGGGAGGAAGCAGCAAGGGAAATCCGCAGGGCAATTACTGGTCGCATTCCTGACAGCCTGAAAAACTGTGTCAATAAAGATCACTTAACTGCAGCAACACATTGGGCCAGCATGGATCCTGGGGTTGTTCATCCAGAGCTCAATGGTGGTGCCTACAGATATTCCCAAGGTGTTGTCAGTGTGGCTCCAGCTGGCATCCCGGCAGCGGTAGAAGGTATAGTACCAACTGCTATGCCTTTATCACATGGTCACCCAGCTGTGGTCCACCCACCCCATGCTCCTTCTCCCGGCCAAACCGTCAAACCAGAGGCCGACAGAGACCATCCAAGTGACCAGTTGTAG
Full Trace Sequence: gtgtatgtgtgtgtgtacccatgtatgtgtgcttgcgcctctatgtgtcttacttctgggaaaaattgaagtggcggccatatgcttaggattaattttccatatctcactcatttttagagaggccggacacacacctccatgggaagttctcacttgctaaacaagggtttgcctctaggcattcgacctccaattatgaacgggcccatgcacccgcgcccattggtagcattgctcgatggcagagattgcaccgtagagatgcccattctgaaggacgtggccactgtggctttctgcgatgcacagtctacacaagaaattcacgaaaaggtgctaaatgaagcggtgggagccctgatgtatcatacgatcacgttaacaagggaagatctggagaagttcaaggctctccgaataattgtccgaatcggaagtgggtttgacaacatcgatatcaagtcagccggggatctaggtattgcagtatgtaacgtgccagcagcctctgtagaggagacagcggattcgaccatgtgccacattttaaacttatacaggagaacgacgtggctgcaccaggcgttaagagaaggaaccagggtgcagagcgtagagcagataagggaggtggcatctggggcagcacggattcgcggggaaactttaggcattataggactcgggcgggttggtcaagcagtggcgctgcgggcaaaaacctttggtttcaacgtctatttctatgacccttacctctcagacggcattgaacgtgcgcttggcctccagcgggtcagcaccctacaagacctcctgttcaatagcgactgtgtaaccctgcactgcagtttaaatgagcacaaccatcaccttattaatgactttaccattaaacagatgaggcagggtgccttcttagtgaacacggcacgaggtggcttggtggatgagaaggcactggcgcaggccctaaaggagggcaggatacgaggagcggcattagatgtacatgagtcggaacctttcagcttcagccagggtgctcttaaagatgcgccaaacctcatctgtacgccacacgcggcttggtacagcgagcaagcgtccatagagatgcgggaggaagcagcaagggaaatccgcagggcaattactggtcgcattcctgacagcctgaaaaactgtgtcaataaagatcacttaactgcagcaacacattgggccagcatggatcctggggttgttcatccagagctcaatggtggtgcctacagatattcccaaggtgttgtcagtgtggctccagctggcatcccggcagcggtagaaggtatagtaccaactgctatgcctttatcacatggtcacccagctgtggtccacccaccccatgctccttctcccggccaaaccgtcaaaccagaggccgacagagaccatccaagtgaccagttgtagccctccagaaagcgatgagcattcccccccggcatctaaggtttcaactccagagaagataagaagaatctggattttaggaaagaggcaaacattctgaacttacaagctgaccttcattgtttttagggactggtccaaatatacagcataacgggagaagaaaagagaatttttgggacctttttttcctccatataaaaattgtagtttgttcctgtccagtggaataacttcactgttctgtgtccaatgggtccttcgttacgcaagaaaagttagtagttaattatatcatgaatgtacttgtctgtgtacagtttttagaacatgaaaacaacaaagggtttgttcgcttagctatcaactgggaataacatgagggaggcattcagcaaaccacttttatggttcaaaaaagctaaaaaaaaaaattaaaaaaaaataaatatatatattattttcttttatatgtttaaaatatgcccaataaagcagtcagttggcagacttctcaggacaatacgtgatcccactttttctttggaagccacacagtgcattgtttttctacctgcttgtcttgtacatttctctttttttaataatttagtaaaaacaggaatttttttttgtgttcatttcccttattttggcatggataccctcctatcggataactacggcaagaacgaaaacaggaaaaaaaaaaaacctaaagcggcgtcgttcttgtcgcaaaagtatatataaatggtggtatgcgggaaatcacgactactgaaagtagttccatttcattgcctacatgaattccttcctggtaatgttggtaggctagcaatatttttattttctttcttttttttttttttttttttattgttttgggtcaagatcatgtttgtgagtgtaaccatttgtatgacttattattttaagaaataaaatcccagacaaataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGSSHLLNKGLPLGIRPPIMNGPMHPRPLVALLDGRDCTVEMPILKDVATVAFCDAQSTQEIHEKVLNEAVGALMYHTITLTREDLEKFKALRIIVRIGSGFDNIDIKSAGDLGIAVCNVPAASVEETADSTMCHILNLYRRTTWLHQALREGTRVQSVEQIREVASGAARIRGETLGIIGLGRVGQAVALRAKTFGFNVYFYDPYLSDGIERALGLQRVSTLQDLLFNSDCVTLHCSLNEHNHHLINDFTIKQMRQGAFLVNTARGGLVDEKALAQALKEGRIRGAALDVHESEPFSFSQGALKDAPNLICTPHAAWYSEQASIEMREEAAREIRRAITGRIPDSLKNCVNKDHLTAATHWASMDPGVVHPELNGGAYRYSQGVVSVAPAGIPAAVEGIVPTAMPLSHGHPAVVHPPHAPSPGQTVKPEADRDHPSDQL
Donor tissue: tailbud