ORFeome > ctbp2 – XORFeome 2.0

ctbp2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis C-terminal binding protein 2, mRNA (cDNA clone MGC:89516 IMAGE:6992806), complete cds
Gene Symbol: ctbp2
Gene ID: 493558
ORF gb_acc: MG133982
ORF ID: 11580

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082524

Library Location

Plate ID: GDExt11016
Well Location: H01

EST Sequences

Clone: MGC:89516 IMAGE:6992806
Trimmed Sequence: ATGGACATGCTTGAGAATGAGAAGATAAAACGGCTGCGTCTGGACCAGATTGGTGAAGGTATGCGCCCCCAGGCTGTGAATGGGCCCCTGCACCCTCGCCCGCTGGTGGCCTTACTGGATGGCAGAGATTGCACGGTGGAGATGCCAATACTGAAAGACCTGGCTACAGTGGCCTTCTGCGATGCCCAGTCTACACAGGAGATCCATGAAAAGGTTCTGAATGAAGCAGTGGGTGCCATGATGTATCACAACATCACACTGACAAGGGAAGATCTGGAGAAATTCAAATCTCTTCGCATTATAGTACGAATAGGGAGCGGATTCGACAACATCGACATCAAGGCTGCTGGAGAACTGGGAATTGCTGTGTGTAACATACCCTCAGCCGCTGTGGAAGAGACAGCAGATTCTACTATCTGTCATATCCTCAATTTGTATCGGAGGAACACATGGTTGTACCAAGCACTGCGGGAGGGGACACGAGTTAACAGCGTGGAACAAATCCGAGAAGTGGCATCAGGAGCAGCAAGGATGCGCGGAGAGACCTTGGGTCTTATCGGCTTTGGTCGCGTTGGACAAGCAGTTGCTGTAAGAGCAAAAGTGTTTGGCTTCAGCATTATCTTTTATGATCCGTACCTGCAGGATGGGATAGAACGCTCTCTGGGAGTGCAGAGGGTATACACCCTCCAGGACTTGTTATACCAAAGTGACTGTGTGTCTCTACACTGTAACCTTAATGAGCATAACCACCACCTCATTAATGACTTTACCATCAAACAGATGAGGCAAGGAGCCTTCCTCGTAAATACAGCTCGAGGGGGCCTTGTGGATGAGAAATCTTTGGCCCAGGCACTGAAGGAGGGTAGAATACGAGGAGCTGCACTTGATGTACATGAAGTTGAACCTTTCATATTTGCTCAGGGCTCACTGAAAGATGCCCCTAACCTGATCTGCACTCCCCACACAGCATGGTACAGTGAGCAGGCCTCTCTCGAGATGAGGGAAGCTGCGGCCACAGAGGTGCGCAGAGCTGTTACAGGTCGCATTCCAGACACTCTTAGAAACTGTGTGAACAAAGAGTTTATAGTGGGATCAGCTCAGTGGCCAACTATGGAGCAGCCAGTGACTAATGCAGAGTTGAACGGTGCCGCCTACAGATCTGTGTGCTCGCAGCCACTGCAGGGAGAGAAGCGCTGA
Full Trace Sequence: cgagctgctcgggaggtatatgtcactatttctccgtccccccggaaacaggaattacataggatcattcaattggtgatcctggagagatgtgacgtgggataagtatgcaaggtaacctgtactttgtgcaagatggacatgcttgagaatgagaagataaaacggctgcgtctggaccagattggtgaaggtatgcgcccccaggctgtgaatgggcccctgcaccctcgcccgctggtggccttactggatggcagagattgcacggtggagatgccaatactgaaagacctggctacagtggccttctgcgatgcccagtctacacaggagatccatgaaaaggttctgaatgaagcagtgggtgccatgatgtatcacaacatcacactgacaagggaagatctggagaaattcaaatctcttcgcattatagtacgaatagggagcggattcgacaacatcgacatcaaggctgctggagaactgggaattgctgtgtgtaacataccctcagccgctgtggaagagacagcagattctactatctgtcatatcctcaatttgtatcggaggaacacatggttgtaccaagcactgcgggaggggacacgagttaacagcgtggaacaaatccgagaagtggcatcaggagcagcaaggatgcgcggagagaccttgggtcttatcggctttggtcgcgttggacaagcagttgctgtaagagcaaaagtgtttggcttcagcattatcttttatgatccgtacctgcaggatgggatagaacgctctctgggagtgcagagggtatacaccctccaggacttgttataccaaagtgactgtgtgtctctacactgtaaccttaatgagcataaccaccacctcattaatgactttaccatcaaacagatgaggcaaggagccttcctcgtaaatacagctcgagggggccttgtggatgagaaatctttggcccaggcactgaaggagggtagaatacgaggagctgcacttgatgtacatgaagttgaacctttcatatttgctcagggctcactgaaagatgcccctaacctgatctgcactccccacacagcatggtacagtgagcaggcctctctcgagatgagggaagctgcggccacagaggtgcgcagagctgttacaggtcgcattccagacactcttagaaactgtgtgaacaaagagtttatagtgggatcagctcagtggccaactatggagcagccagtgactaatgcagagttgaacggtgccgcctacagatctgtgtgctcgcagccactgcagggagagaagcgctgagcggcatctgcaacctatgccttggtggtggccattatctcagccagcagtacatcaacgccagggacgggtccaaatggcattaccagtttatataacatcccctcagtgattccttcttccaccagctctcatgtgacagggaccaatatactgagcaatagaacatggctgtgagcgacagtttactgcagccaaggaacacagatctaaaaccagactacccatcagtttaggagaaaggagcggaggtgtctattctagtactagagtcggcagccatgttatcctactgtgcattgttatacctcactgataccgacgcaaggcaagagggtgctttggataagcaatgtccacccaatcttagcagcgtccgctccgcatctgtcctacaggatggagatatccagccaattccacttgaggactgggattacatgggaaagcagaaccagaacactggcactcaatggtcgtccaacgccaatcagaaggcatatttagtgtgtttttatcttgtctgtttgtccttctgctccaatggctcaggaaatctattgtctaggtacaaaagaattattttctaacactgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDMLENEKIKRLRLDQIGEGMRPQAVNGPLHPRPLVALLDGRDCTVEMPILKDLATVAFCDAQSTQEIHEKVLNEAVGAMMYHNITLTREDLEKFKSLRIIVRIGSGFDNIDIKAAGELGIAVCNIPSAAVEETADSTICHILNLYRRNTWLYQALREGTRVNSVEQIREVASGAARMRGETLGLIGFGRVGQAVAVRAKVFGFSIIFYDPYLQDGIERSLGVQRVYTLQDLLYQSDCVSLHCNLNEHNHHLINDFTIKQMRQGAFLVNTARGGLVDEKSLAQALKEGRIRGAALDVHEVEPFIFAQGSLKDAPNLICTPHTAWYSEQASLEMREAAATEVRRAVTGRIPDTLRNCVNKEFIVGSAQWPTMEQPVTNAELNGAAYRSVCSQPLQGEKR
Donor tissue: neurula