ORFeome > ddb2 – XORFeome 2.0

ddb2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ddb2 protein, mRNA (cDNA clone MGC:79581 IMAGE:6978878), complete cds
Gene Symbol: ddb2
Gene ID: 493565
ORF gb_acc:
ORF ID: 11194

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080928

Library Location

Plate ID: GDExt11012
Well Location: D01

EST Sequences

Clone: MGC:79581 IMAGE:6978878
Trimmed Sequence: ATGCCCCCCAAAAGAGCAACACGTGGGAGGAGGAATGTGGAGCTGTCTTCAGAGGAGGAAGAGGAGCAGGAAGAAGTTTCCCCAGGAAAAAGGAAACGGGACATAGAGAAAAATGGTGAAGCCAGGCTCAAGAAACCCTCTAAGAAGAGAAGCGGGCAGCAGTGTGCCTCAGATGTACCATGCAGCAGTAAAGAGTCCGACTGTGGTACAAACCTCACTAACAAAGGAGACAAGCAGAGAAGCATCGTGCACTACCTGTATCGCAGCACTCTGGGGGGCAATGTCCGGGCAAAGTACCTGCAAACCCCTTTTCTCCGGTCCCTGGCTTCATACATATTATATCGGACCAACAGCCCCTTTGATCGCAGAGTTACCACTCTTGAGTGGCACCCTACGCACCCGAATACAGTGGCGGTGGGATCAAAAGGAGGAGACATCATTCTGTGGGACTATGAAGAGCTCAATAACACCCTCATTCCTGGGATTGGAGCCGGGGGGTGCATCACCGGAATGAAGTTCGACCCGTTTAACCCTAATCAGTTGTACACCTCATCAGTGGCGGGTAGCACCGTGCTACAGGACTTCTCTGGGCGCAATATTCAGACATTCACCAACACTGAGGACTGGGCGATGTGGTACTGCAGCCTCGATGTTTCCGCTGAAAGGCAGTGTGTGGTCACGGGGGATAATGTAGGCAACGTGGTCCTCCTGGAGACCTGTGGGAAGGAGATCTGGAAGTTACGGCTTCACAAAAAGAAAGTGACGCATGTAGAGTTTAACCCTCGCTGTGATTGGCTGCTGGCGTCCGCTTCTGTGGATCAGACCGTGAAGCTGTGGGACCTGCGCAATATCAAAGACAAGTCCAGCTACCTGTACACATTGCCTCATGCACGTGGCGTCAACTCTGCTTATTTTAGCCCCTGGGATGGGGCAAAGCTACTCACTACCGATCAGCACAGTGAGATCCGTGTCTATTCTGCGTGTGATTGGGCCAAACCGCAGCACATAATACCTCATCCACACCGGCAATTCCAACATTTGACTGCAATTAAGGCCACGTGGCATCCTCGCTATGATTTAATAGTTGTTGGCCGATACCCAGACCCGCTCTTTCCAGGCTATATGTCAGATGAGCTTCGGACGGTAGATGTGTTTGATGGACAGAAAGGGAATATTGTATGCCAGCTGTATGACCCTTATGCTTCTGGTATTGTTTCGCTCAACAAATTTAATCCAATGGGAGATCTTCTGGCTTCTGGCATGGGTTTTAATATCTTGATTTGGAGCCGGGAGATTCTGTTGATGATGAAGCAGGAGGAGATGATGAAGGCTTTGAGGGAGAAGGGGGTTTCAGTGGGAAGGAAGGAACTTCCGAATTCCAGATTGCCACATTCCAGCGCTCCCAGAGAGAAGCCTGGGAATAAAGGCAGCACCACGGAGAGCAGCAAGACCCGGACTGTGAGGGAATCTTCTAAACGTGGGAAGCACAAAGACCCGGGCAAATGA
Full Trace Sequence: cttgagaggagaataatgcgaatgtagcgccgagctctctgcgctgggtttgtgcagtggctgcagcacggagagggatgggtgggcgatagagccgctgagaggaatgggtttgcccggcgctgggcgctgatctgctccgccttattctgtccctggagagaagcgcggttcgcatgacagatgccccccaaaagagcaacacgtgggaggaggaatgtggagctgtcttcagaggaggaagaggagcaggaagaagtttccccaggaaaaaggaaacgggacatagagaaaaatggtgaagccaggctcaagaaaccctctaagaagagaagcgggcagcagtgtgcctcagatgtaccatgcagcagtaaagagtccgactgtggtacaaacctcactaacaaaggagacaagcagagaagcatcgtgcactacctgtatcgcagcactctggggggcaatgtccgggcaaagtacctgcaaaccccttttctccggtccctggcttcatacatattatatcggaccaacagcccctttgatcgcagagttaccactcttgagtggcaccctacgcacccgaatacagtggcggtgggatcaaaaggaggagacatcattctgtgggactatgaagagctcaataacaccctcattcctgggattggagccggggggtgcatcaccggaatgaagttcgacccgtttaaccctaatcagttgtacacctcatcagtggcgggtagcaccgtgctacaggacttctctgggcgcaatattcagacattcaccaacactgaggactgggcgatgtggtactgcagcctcgatgtttccgctgaaaggcagtgtgtggtcacgggggataatgtaggcaacgtggtcctcctggagacctgtgggaaggagatctggaagttacggcttcacaaaaagaaagtgacgcatgtagagtttaaccctcgctgtgattggctgctggcgtccgcttctgtggatcagaccgtgaagctgtgggacctgcgcaatatcaaagacaagtccagctacctgtacacattgcctcatgcacgtggcgtcaactctgcttattttagcccctgggatggggcaaagctactcactaccgatcagcacagtgagatccgtgtctattctgcgtgtgattgggccaaaccgcagcacataatacctcatccacaccggcaattccaacatttgactgcaattaaggccacgtggcatcctcgctatgatttaatagttgttggccgatacccagacccgctctttccaggctatatgtcagatgagcttcggacggtagatgtgtttgatggacagaaagggaatattgtatgccagctgtatgacccttatgcttctggtattgtttcgctcaacaaatttaatccaatgggagatcttctggcttctggcatgggttttaatatcttgatttggagccgggagattctgttgatgatgaagcaggaggagatgatgaaggctttgagggagaagggggtttcagtgggaaggaaggaacttccgaattccagattgccacattccagcgctcccagagagaagcctgggaataaaggcagcaccacggagagcagcaagacccggactgtgagggaatcttctaaacgtgggaagcacaaagacccgggcaaatgaacataggcttcagcgcccaactggtcaacatttcaaacatggagtatggcagccagcgcgataccacatccttgggattgttaggttgctggagccgaacccatagtgccttattgcactgctttatgtgtttcaatacaaggttgcgctgtattttcacatccagaactttttcatgactaaaatgatttttagcgagggtcccagtattacaccctgcatctccgctctgacgagtccagtccagtcagtgaattggcttaatcatctgccccctgctggcttctggtatacattactatttgctttcagggcatggtatgtgttgtctttctattttttttttctttatattatatatatacaaacaaaataaatgtggatccatgttaaaatggattctcaaacagaagcgcctgggtgctgacagactgatcatcccttggaatcttggattgcccatgagtccaggccttcggatgaagaccgctgcaccagtggttattgaacagtagagaacaggatcatgggatgggcaacacagatgtaacacatcccctttattcttgcgttcaggtaagaagccgggggacaccgtggaacaagtgagactgactaccggtgggaactattggcatggcgggggcggggggggctgattctgtttgggacattaccataggaatcctttagttctgaggccaaaaagtcttgaagaatatggaaaataaatgtgacttccatcctgaaaaaaaaaaaaaaaaaaa
Translation: MPPKRATRGRRNVELSSEEEEEQEEVSPGKRKRDIEKNGEARLKKPSKKRSGQQCASDVPCSSKESDCGTNLTNKGDKQRSIVHYLYRSTLGGNVRAKYLQTPFLRSLASYILYRTNSPFDRRVTTLEWHPTHPNTVAVGSKGGDIILWDYEELNNTLIPGIGAGGCITGMKFDPFNPNQLYTSSVAGSTVLQDFSGRNIQTFTNTEDWAMWYCSLDVSAERQCVVTGDNVGNVVLLETCGKEIWKLRLHKKKVTHVEFNPRCDWLLASASVDQTVKLWDLRNIKDKSSYLYTLPHARGVNSAYFSPWDGAKLLTTDQHSEIRVYSACDWAKPQHIIPHPHRQFQHLTAIKATWHPRYDLIVVGRYPDPLFPGYMSDELRTVDVFDGQKGNIVCQLYDPYASGIVSLNKFNPMGDLLASGMGFNILIWSREILLMMKQEEMMKALREKGVSVGRKELPNSRLPHSSAPREKPGNKGSTTESSKTRTVRESSKRGKHKDPGK
Donor tissue: tailbud