ORFeome > des.1 – XORFeome 2.0

des.1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis desmin, gene 1, mRNA (cDNA clone MGC:75911 IMAGE:5383608), complete cds
Gene Symbol: des.1
Gene ID: 394739
ORF gb_acc: MG132984
ORF ID: 10364

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061361

Library Location

Plate ID: GDExt11004
Well Location: G10

EST Sequences

Clone: MGC:75911 IMAGE:5383608
Trimmed Sequence: ATGAGCCAGTCCTACTCAAGCAACCAGCGGGTTTCCTCCTACCGCCGCACTTTTGGTGGGGGATCCCCATCATTCAACACCAGGACCTCCTTTGGGTCTAAGGGAGCCTCCTCTAGCTCAGTGTCTTCCAGAGTATACCAAGTGTCTCGGTCTTCTGCAGCCCCGAGCCTCTCAAGCTTTAGGGCCACCAGGGTCGCCCCAGTAAGAAGCAGCTATGGAGCAGATGTTCTGGACTTCAGCCTTGCAGATGCCATGAACCAGGAGTTCCTTCAAACAAGAACCAATGAAAAGGTGGAGCTGCAAGAGCTGAACGACAGGTTCGTCAACTATATCGAGAAGGTCCGGTACCTGGAGCAGCAGAACCAGATTCTTGTGGCTGAAGTCAACAAGCTCAAGGGGAAAGAGCCAACCAGGGTGAATGAGCTGTACGAAGAAGAGATGAGGGAGCTGCGCCGCCAAGTGGACCTCGCCACCAATCAGAGGTCACGAGTGGAGGTGGAAAGGGACAACCTGGTAGACGACCTACAGAAGTTGAAGTTGAGGTTGCAGGAGGAGATCCAGTTGAAGGAAGATGCTGAGAACAATCTCGCTGCTTTCAGAGCGGACGTTGACGCCGCCACCCTGGCCCGCATTGACCTGGAGAGGCGCATTGAGTCTTTGCAGGAGGAAATCGCATTCCTGAAAAAGATTCACGAGGAGGAAATCCGGGAACTGCAGGCACAGATGCAAGAGCAACAGCTGCAAGTGGAGATAGATGTTTCCAAACCCGACCTGACGGCAGCACTCAGAGATATCCGGGCTCAGTATGAGAACATCGCTGCCAAGAATGTCTCTGAGGCCGAGGAGTGGTACAAGTCCAAGGTCAGTGACCTCAACCAGGCAGCTCAGAAGAACAACGATTCCCTGCGCCAGGCCAAGCAAGAGATGATGGAATACCGCCACCAAATTCAGTCCTACACCTGTGAGATTGATGCACTTAAGGGAACAAACGACTCCTTGATGCGCCAGATGAGGGACCTCGAGGAAAGGTTTTCTGGGGAAGCCGCTGGGTACCAGGACTCCATTGGACGTTTGGAGGAAGAGATCCGTAATATGAAGGATGAAATGGCAAGGCATCTCCGCGAGTATCAGGATCTCCTGAACGTCAAGATGGCGCTGGATGTGGAAATTGCCACATACCGTAAACTGCTCGAGGGCGAGGAGAGCAGGATCACTCTTCCCATCCAAACATACTCTGCACTCAGTTTCCGAGAAACCAGCCCAGAGCAGAGAGCTTCAGAAGTCCACACAAAGAAAACAGTCATGATCAAAACCATTGAGACCCGGGATGGTGAGGTTGTAAGTGAGGCTTCCCAGCAGCACCAGGAGATCCTGTAA
Full Trace Sequence: tgcctcttcatcccaactgagccaacacccaggctcccatcagccaccatgagccagtcctactcaagcaaccagcgggtttcctcctaccgccgcacttttggtgggggatccccatcattcaacaccaggacctcctttgggtctaagggagcctcctctagctcagtgtcttccagagtataccaagtgtctcggtcttctgcagccccgagcctctcaagctttagggccaccagggtcgccccagtaagaagcagctatggagcagatgttctggacttcagccttgcagatgccatgaaccaggagttccttcaaacaagaaccaatgaaaaggtggagctgcaagagctgaacgacaggttcgtcaactatatcgagaaggtccggtacctggagcagcagaaccagattcttgtggctgaagtcaacaagctcaaggggaaagagccaaccagggtgaatgagctgtacgaagaagagatgagggagctgcgccgccaagtggacctcgccaccaatcagaggtcacgagtggaggtggaaagggacaacctggtagacgacctacagaagttgaagttgaggttgcaggaggagatccagttgaaggaagatgctgagaacaatctcgctgctttcagagcggacgttgacgccgccaccctggcccgcattgacctggagaggcgcattgagtctttgcaggaggaaatcgcattcctgaaaaagattcacgaggaggaaatccgggaactgcaggcacagatgcaagagcaacagctgcaagtggagatagatgtttccaaacccgacctgacggcagcactcagagatatccgggctcagtatgagaacatcgctgccaagaatgtctctgaggccgaggagtggtacaagtccaaggtcagtgacctcaaccaggcagctcagaagaacaacgattccctgcgccaggccaagcaagagatgatggaataccgccaccaaattcagtcctacacctgtgagattgatgcacttaagggaacaaacgactccttgatgcgccagatgagggacctcgaggaaaggttttctggggaagccgctgggtaccaggactccattggacgtttggaggaagagatccgtaatatgaaggatgaaatggcaaggcatctccgcgagtatcaggatctcctgaacgtcaagatggcgctggatgtggaaattgccacataccgtaaactgctcgagggcgaggagagcaggatcactcttcccatccaaacatactctgcactcagtttccgagaaaccagcccagagcagagagcttcagaagtccacacaaagaaaacagtcatgatcaaaaccattgagacccgggatggtgaggttgtaagtgaggcttcccagcagcaccaggagatcctgtaagccgccatcttgtctccctggccgtgggcacgcaacaggaagaaaagaacacccacatggcacagcctgagtgcaaccctgctggacaaatggcatctcatgttgtaccttcaccacattaccttctgcacctatcacttgtcccttctgtctaaggaccccttgtccccaaagctcatataggagccgctcagtattatgaactctcctgctaagagacatccgtgttggggatgtctcggcagaaatacagggaaaccggaaataaagtcacagtcacccataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSQSYSSNQRVSSYRRTFGGGSPSFNTRTSFGSKGASSSSVSSRVYQVSRSSAAPSLSSFRATRVAPVRSSYGADVLDFSLADAMNQEFLQTRTNEKVELQELNDRFVNYIEKVRYLEQQNQILVAEVNKLKGKEPTRVNELYEEEMRELRRQVDLATNQRSRVEVERDNLVDDLQKLKLRLQEEIQLKEDAENNLAAFRADVDAATLARIDLERRIESLQEEIAFLKKIHEEEIRELQAQMQEQQLQVEIDVSKPDLTAALRDIRAQYENIAAKNVSEAEEWYKSKVSDLNQAAQKNNDSLRQAKQEMMEYRHQIQSYTCEIDALKGTNDSLMRQMRDLEERFSGEAAGYQDSIGRLEEEIRNMKDEMARHLREYQDLLNVKMALDVEIATYRKLLEGEESRITLPIQTYSALSFRETSPEQRASEVHTKKTVMIKTIETRDGEVVSEASQQHQEIL
Donor tissue: neurula