ORFeome > dlx3 – XORFeome 2.0

dlx3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis distal-less homeobox 3, mRNA (cDNA clone MGC:69301 IMAGE:5308608), complete cds
Gene Symbol: dlx3
Gene ID: 594954
ORF gb_acc: MG134250
ORF ID: 11911

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090605

Library Location

Plate ID: GDExt11019
Well Location: B03

EST Sequences

Clone: MGC:69301 IMAGE:5308608
Trimmed Sequence: ATGAGCGGGTCCTATGAAAAGAAGATGGCAGTGTTGACCGACCTGACCACTTCTTGTCATCCTGTGACCAAGGACTCTCCCACCCTGCCAGAGTCAACCGCCACGGATATGGGCTATTATAGCGGTCACCTCTCTGGTGGGCAGCACGACTTCTTCCAGACTCAAGCGTACTCCCCATCTATCAGCAGCTATGGCTACCACCACCCCCACCATCAGTACAACTTTAATGGGCTAGTAGGGAACGAGAGCTTTCTGCCCAAGGATGACTATCAGTATGGAGGGGGATATCGGGCGTTTGGGCATTACAGAGAGCCTCCAGTGCCGGAGACAGTTTCAGTGAAGGAAGAGCCAGAAACCGAAGTTCGGATGGTTAATGGGAAACCTAAAAAGATCCGAAAGCCAAGAACCATCTATTCTAGTTACCAGCTGGCTGCATTGCAGAGAAGGTTCCAGAAGGCCCAATATTTGGCACTGCCCGAGAGAGCAGAACTAGCCGCCCAGTTAGGGCTCACTCAAACGCAGGTAAAAATTTGGTTCCAGAACCGAAGATCTAAGTTTAAAAAACTGTACAAAACCGGAGAAGGGCCTGGTTTGGAACACAGTCCGAATAACAGCGACTCCATGGCTTGCAATTCCCCTTCATCCCCACCCGTATGGGACAATAGTCGAAGCCGAACCCCTCAGCAGCAGCAGCAGCAAAGTCTTCCACCGTGCTCTTCACCCTCTTATATGGAGAACTACCATCCGTGGTACACCCAGCAAACCCAACCTGGCCAGCACCTACAACCATCTGAAGTTATGCATCAACCTCCTTCCAATACAGTGTATTAA
Full Trace Sequence: gtctgattaatttccagggagctctcttctccggctctacaaaccatgagcgggtcctatgaaaagaagatggcagtgttgaccgacctgaccacttcttgtcatcctgtgaccaaggactctcccaccctgccagagtcaaccgccacggatatgggctattatagcggtcacctctctggtgggcagcacgacttcttccagactcaagcgtactccccatctatcagcagctatggctaccaccacccccaccatcagtacaactttaatgggctagtagggaacgagagctttctgcccaaggatgactatcagtatggagggggatatcgggcgtttgggcattacagagagcctccagtgccggagacagtttcagtgaaggaagagccagaaaccgaagttcggatggttaatgggaaacctaaaaagatccgaaagccaagaaccatctattctagttaccagctggctgcattgcagagaaggttccagaaggcccaatatttggcactgcccgagagagcagaactagccgcccagttagggctcactcaaacgcaggtaaaaatttggttccagaaccgaagatctaagtttaaaaaactgtacaaaaccggagaagggcctggtttggaacacagtccgaataacagcgactccatggcttgcaattccccttcatccccacccgtatgggacaatagtcgaagccgaacccctcagcagcagcagcagcaaagtcttccaccgtgctcttcaccctcttatatggagaactaccatccgtggtacacccagcaaacccaacctggccagcacctacaaccatctgaagttatgcatcaacctccttccaatacagtgtattaagtgaaaaaagacactggcactaatttatctttgtgccctcctgtattttatttttattttttttggaatttgatgacagtcaaaaagtttgaaaaacaatgtcagctcaaggtcaaaccgataattaggtgcattttatacacagcacctaaagaattgcttgatccctcaggctgagtggtttggatggacaatattttggagattatccattattttggatgccactatacgtcagtctttctcgaaccttggattctcgaaccttgtgttgggcctcttaatttatcattaatgaaagtgacattaatgtaatgttctaaagtatagattctcattcttttatgcctctcctgacaaccatggtttaaatactgcaatagctgaattaaaactctaaaggtgttatttttaagaccctttcctggacttgttgctgtttgaccaatgtgatattctgtgccttagtaaatgaagctatatttaaataatagatccatttttacgttttataagggacaagaagcaaaatattccataactctactgaatcgagatacaaagacttgtagagttgattctgcctgggactgtaagatgtggctgcatctcagtggcctcaccagcttccataaaggaacatcgaatggtcaaagggtcccgaattcagtgtcactccatggtggaacggacttctttccagagctgctgtttgtgtaacttggtcacgttcctgtgtcatggaaatatttaaaacaaaaacaaaacaaaaaaaagactatggttggccttaacttatttttgtaatatttttggggggttgtgtttggaatgggaggagaagatgatgagaactaactttgattagaagatgggggggggggggggtgttaaagaatgttatggtgtgaatgcaaataaatttttatggtattttgctggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSGSYEKKMAVLTDLTTSCHPVTKDSPTLPESTATDMGYYSGHLSGGQHDFFQTQAYSPSISSYGYHHPHHQYNFNGLVGNESFLPKDDYQYGGGYRAFGHYREPPVPETVSVKEEPETEVRMVNGKPKKIRKPRTIYSSYQLAALQRRFQKAQYLALPERAELAAQLGLTQTQVKIWFQNRRSKFKKLYKTGEGPGLEHSPNNSDSMACNSPSSPPVWDNSRSRTPQQQQQQSLPPCSSPSYMENYHPWYTQQTQPGQHLQPSEVMHQPPSNTVY
Donor tissue: gastrula