ORFeome > dmap1 – XORFeome 2.0

dmap1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis DNA methyltransferase 1 associated protein 1, mRNA (cDNA clone MGC:69506 IMAGE:5336404), complete cds
Gene Symbol: dmap1
Gene ID: 448027
ORF gb_acc: MG133359
ORF ID: 10862

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074546

Library Location

Plate ID: GDExt11008
Well Location: B06

EST Sequences

Clone: MGC:69506 IMAGE:5336404
Trimmed Sequence: ATGGCTACAGGAGCAGATGTTCGGGATATTCTGGAATTGGGGGGTGGGGATTCAGAGGTCACTGGAATCATCAACAAAAAGGACATCATTAATGCAGATAAGAAAAAATCCAAGAAATCTTCAGAGACTCTCACTTTTAAGAGACCGGAGGGCATGCATCGCGAGGTTTACGCACTTCTCTACTCTGACAAAAAGGATGCACCACCGTTACTACCAAGTGATACTACACAGGGCTACCGCACAGTGAAGGCAAAACTAGGCTGCAAGAAAGTTCGGCCCTGGAAATGGATGCCATTCACAAATCCTGCAAGAAAGGATGGAGCTATTTTTTTCCACTGGCGTCGAGCTTCAGAAGAAGGAAAGGACTACCCCTTTGCCAGGTTTAATAAATCTGTACAGGTTCCAGTTTACTCAGAACAGGAGTATCAGATGTATTTGCATGATGATGGCTGGACTAAAGCTGAGACAGACCATCTTTTTGACCTCTGCCGACGTTTTGATCTGCGATTCATTGTTATCCATGACCGATATGATCATCAGCAGTTTAAGAAAAGGTCAGCAGAGGATCTGAAAGATCGTTATTATGGCATTTGTGCTAAGCTGGCAAATATTCGTGCCACCCCAGGGACAGACATGAAAATCCCTGTATTTGATGCAGGACATGAGAGGAGGAGAAAGGAGCAGCTGGAAAGATTGTACAACAGGACACCAGAGCAGGTGTCAGAGGAGGAATATCTAATTCAGGAGCTGCGGAAAATTGAAAGCAGAAAGAAGGAGCGAGAAAAGAAAGCCCAGGATCTGCAGAAACTTATTACTGCAGCTGATACCACCACAGAGCTGAGGCGTGCTGAACGCAAGGCAACGAAAAAGAAGCTACCACAAAAGAAGGAAACTGAAAAGCCTGCAGTACCGGAAACAGCTGGGATCAGGTTTCCTGATTTTAAATCTGCGGGAGTTACGCTGCGCAGCCAGAGGATGAAACTGCCAAGCTCAGTTGGACAGAAGAAGATTAAAGCCCTGGATCAGATGCTAACAGAACTAGGAGTAGACTTGAACCCAATGCCAACAGAGGAAATTGTGCAAATGTTTAATGAGCTTCGCAGTGATCTAGTGCTGCTGTATGAACTGAAGCAAGCCTTCTCCAGCTGTGAGTATGAGTTGCAGATGTTGCGCCATCGCTTTGAAGCCCTCTCCAAAAGCGGAAGCACAAGCACAGTTTTACCGGGAGATGGAGTTGCTGGGGAAAGTCAGGCAGCCTCCGGCACAGAAGAAGTGAAATCAGAAGCAAAAGATCCCATCATTGATGTTGTCGGGGCCCCGCTAACACCCAATTCGAGAAAAAGGAGGGAATCTGCCTCCAGCTCATCATCAGTGAAGAAGATGAAGAAGCCTTGA
Full Trace Sequence: tagattaaagctgtgcggagaccttcactaaaggttgaaaaatggctacaggagcagatgttcgggatattctggaattggggggtggggattcagaggtcactggaatcatcaacaaaaaggacatcattaatgcagataagaaaaaatccaagaaatcttcagagactctcacttttaagagaccggagggcatgcatcgcgaggtttacgcacttctctactctgacaaaaaggatgcaccaccgttactaccaagtgatactacacagggctaccgcacagtgaaggcaaaactaggctgcaagaaagttcggccctggaaatggatgccattcacaaatcctgcaagaaaggatggagctatttttttccactggcgtcgagcttcagaagaaggaaaggactacccctttgccaggtttaataaatctgtacaggttccagtttactcagaacaggagtatcagatgtatttgcatgatgatggctggactaaagctgagacagaccatctttttgacctctgccgacgttttgatctgcgattcattgttatccatgaccgatatgatcatcagcagtttaagaaaaggtcagcagaggatctgaaagatcgttattatggcatttgtgctaagctggcaaatattcgtgccaccccagggacagacatgaaaatccctgtatttgatgcaggacatgagaggaggagaaaggagcagctggaaagattgtacaacaggacaccagagcaggtgtcagaggaggaatatctaattcaggagctgcggaaaattgaaagcagaaagaaggagcgagaaaagaaagcccaggatctgcagaaacttattactgcagctgataccaccacagagctgaggcgtgctgaacgcaaggcaacgaaaaagaagctaccacaaaagaaggaaactgaaaagcctgcagtaccggaaacagctgggatcaggtttcctgattttaaatctgcgggagttacgctgcgcagccagaggatgaaactgccaagctcagttggacagaagaagattaaagccctggatcagatgctaacagaactaggagtagacttgaacccaatgccaacagaggaaattgtgcaaatgtttaatgagcttcgcagtgatctagtgctgctgtatgaactgaagcaagccttctccagctgtgagtatgagttgcagatgttgcgccatcgctttgaagccctctccaaaagcggaagcacaagcacagttttaccgggagatggagttgctggggaaagtcaggcagcctccggcacagaagaagtgaaatcagaagcaaaagatcccatcattgatgttgtcggggccccgctaacacccaattcgagaaaaaggagggaatctgcctccagctcatcatcagtgaagaagatgaagaagccttgagacgattgagcagcacagacagaaagcaagaggcgctgtgattccctggccctgttccacaagccgtcttaagtgtttgggcagaaaccagacaagccccaggcttttggcattctagattgccgtatattagtcgtatggatgtacatattgtctgcttatgtttgtgtttaaacaacaagtacactgtgaaaacatttctatgtatcctttttacccatctgtcctgcctctgggacacttgctttccagagttaatttgctgtccttgttctaaaggaagcagaattgttacaaggatgtcaggtatttataaaatctgaggaaatgggatttaaggagaccacgtgtgagcctgaatggaggaattgagttttgctttgtttctctattaataaacaggtcatgtaattgataagtgggaccataataaacaaccttctcctgttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MATGADVRDILELGGGDSEVTGIINKKDIINADKKKSKKSSETLTFKRPEGMHREVYALLYSDKKDAPPLLPSDTTQGYRTVKAKLGCKKVRPWKWMPFTNPARKDGAIFFHWRRASEEGKDYPFARFNKSVQVPVYSEQEYQMYLHDDGWTKAETDHLFDLCRRFDLRFIVIHDRYDHQQFKKRSAEDLKDRYYGICAKLANIRATPGTDMKIPVFDAGHERRRKEQLERLYNRTPEQVSEEEYLIQELRKIESRKKEREKKAQDLQKLITAADTTTELRRAERKATKKKLPQKKETEKPAVPETAGIRFPDFKSAGVTLRSQRMKLPSSVGQKKIKALDQMLTELGVDLNPMPTEEIVQMFNELRSDLVLLYELKQAFSSCEYELQMLRHRFEALSKSGSTSTVLPGDGVAGESQAASGTEEVKSEAKDPIIDVVGAPLTPNSRKRRESASSSSSVKKMKKP
Donor tissue: tailbud