ORFeome > dtl – XORFeome 2.0

dtl – XORFeome 2.0

General Information

Species: Xenopus tropicalis denticleless homolog (Drosophila), mRNA (cDNA clone MGC:75574 IMAGE:5379105), complete cds
Gene Symbol: dtl
Gene ID: 395039
ORF gb_acc: MG132795
ORF ID: 10124

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064851

Library Location

Plate ID: GDExt11002
Well Location: G04

EST Sequences

Clone: MGC:75574 IMAGE:5379105
Trimmed Sequence: ATGTTGTTTCGATCTGTGGTAAACAAACCTCGCTTGGGCTGCAGGCAAAGGGGTGTCCCTTTTACACACCCCCTTCAGTCTCTGCTACAATGTTATCAATGTGCCAAACATGATGAGCATACTTCGTATGGGGAGTTGGGTGCCGCTGTTCCACCTTTCGGATGTGCCTTTAGTACAGTGCCGGACATGTCTCATGTACTTGCTGTTGCCAACGAAGAAGGCATAGTCAGGCTGTATGATACAGAGTGCCGGGATGTACAAAGGCTTGTTGTGAAAGAATTCATGGCGCACACTAATGCTGTTTTTGACATTGCCTGGGTGCCTGGGGAACACAAGCTAGTTACAGCTTCAGGGGACCAAACTGCAAAGCTGTGGGACGTGAAGGCTGGGGATCTGATTGGAGAGTGTAAAGGACACCAGTGCAGCCTGAAGTCTGTTGCCTTCTCAAAATTTGAGAAAGCTGTTTTCAGTACTGGAGGAAGAGATGGAAACATCATGGTGTGGGACACTAGATGCAATAAGAAAGATGGTTTTTACAGGCAAGTGAACCAGATCACTGGTGCACATAATGCCCTTGACAAGCAGACCCCTTCCAAGGTGAAGAAAAGGAAGCCTTACGTCAGAGGTCTCGCTCCTTCAGTGGATTCCCAGCAGAGTGTGACTGTGGTAATCTTTCAAGATGAGCACACCATTATCTCGGCAGGAGCAGTGGATGGTATTGTCAAGGTTTGGGACTTGAGGAAAAACTACAGTGCGTATCGGCAGGATCCTGTGCCAGCGAAACTCTTTCCTTATCCAGGAAATAGCACCCGCAAACTTGGTTACTCCAATCTTGTACTCGACCCAACTGGCACAAACCTGTTTGCGAGCTGTACAGATGATAATGTGTATATGTTTAATGCAACCGGTCTAAAGACTGAGCCAGTTTCCGTCTTCGGCGGTCACCAGAATTCCACTTTCTACATAAAGACCAGCGTCAGTCCAGACGGGCAGTTTCTTCTCAGTGGCTCCAGTGATCATAGTGCCTACATCTGGCAGGTGTCTGATCCCAAGGTTCCTCCTGTCACCCTGACGGGACATTGTCAAGAAGTCACCTCTGTAGCTTGGTGCCAGTCAGACTTTACAAAGATTGCCACGTGCTCTGATGACAACACCGTGAGAGTATGGAGACTGAAGAGAAGTAGCGAGGACTCTGCGCAGTCGGATAAAACCGAAACTGTTGGTTGGGCCTGCCAAAAGAAATGTGTACCGCCTTCTATGGCCGCAAACCTCTGTACGCCTGGGAAGCCTTCAATGATACCAAGCAGTTCCCTGATGTCTTCCCCAACACCAGCCACGTGTGCCCCAAGTTACACGGGAGACCTGCCAATGCCCTCCAGCACTCCTGTATCTGCCTTGTTGCCAATTCCTAAGCTGCAGACTCCACAAAGGCTGAATGGCGAGGGTTTAGGAGCATCTCCCAAACAGACGTCCTCTTCAAAAATTTCAATTAAGGACTGGATCACCCGCACTCCCAAGTCATCCACACGGGCTGATACAAAGACACCCTCTCCCCGCAAAGCCTTCACCCCCGTGGAGCAGTACCCAAGCGTATCAAGTACAAGGGTACAGATGCCCTATGAGAAGAGGGCCAAGAGGCGCCTGGAAACCAGCAGCGAAGATGTGGAACATGTCTGCCTTGACCATTGCAACTGTGTGATGGAGTTGGAGCCTGGGCTGAAGAAAGCAAAACTGGACTTGTGTTCTTTCAGTGAGAAAGAGAGAGACGGCAGCGATGATAAATGCCTGAGGCTTTCAGACTTGAGTAGGGGATTTGACCAAGAATTCTCTCCCGGTCCGTCAACATCCTTCCTTATTAATGGTACAGTTAACCCCCCTCTAAGTCCTCTGTCTGAGTTGAAAAGTGACTTGCGAGACAAAGAAAACAGTTCCCCAGAGAAAAACTGGCTCTCTGCTTTAGGGCACAAATTCAAGTCGGACAAGTCTTCCCCTCAGAATAAAGCTGCCAGCAGCCCCTCCTCTAGGAACAGCACCTCTAAAAAACATCCGACAAGGAATGCTCCCAATTCACCAGTATCTGTACCAACGACCCCCGGCTCAATGAGAAAAATCTGCACCTACTTCTTTAAGAAATCCGAGTAA
Full Trace Sequence: ctgtgtgaggggaaggagtgcaggagcggagctctcccttggggcctttatcgctgctgttactgcttggatccgcatctgccatagctgagatctcattcattcctcgccatgttgtttcgatctgtggtaaacaaacctcgcttgggctgcaggcaaaggggtgtcccttttacacacccccttcagtctctgctacaatgttatcaatgtgccaaacatgatgagcatacttcgtatggggagttgggtgccgctgttccacctttcggatgtgcctttagtacagtgccggacatgtctcatgtacttgctgttgccaacgaagaaggcatagtcaggctgtatgatacagagtgccgggatgtacaaaggcttgttgtgaaagaattcatggcgcacactaatgctgtttttgacattgcctgggtgcctggggaacacaagctagttacagcttcaggggaccaaactgcaaagctgtgggacgtgaaggctggggatctgattggagagtgtaaaggacaccagtgcagcctgaagtctgttgccttctcaaaatttgagaaagctgttttcagtactggaggaagagatggaaacatcatggtgtgggacactagatgcaataagaaagatggtttttacaggcaagtgaaccagatcactggtgcacataatgcccttgacaagcagaccccttccaaggtgaagaaaaggaagccttacgtcagaggtctcgctccttcagtggattcccagcagagtgtgactgtggtaatctttcaagatgagcacaccattatctcggcaggagcagtggatggtattgtcaaggtttgggacttgaggaaaaactacagtgcgtatcggcaggatcctgtgccagcgaaactctttccttatccaggaaatagcacccgcaaacttggttactccaatcttgtactcgacccaactggcacaaacctgtttgcgagctgtacagatgataatgtgtatatgtttaatgcaaccggtctaaagactgagccagtttccgtcttcggcggtcaccagaattccactttctacataaagaccagcgtcagtccagacgggcagtttcttctcagtggctccagtgatcatagtgcctacatctggcaggtgtctgatcccaaggttcctcctgtcaccctgacgggacattgtcaagaagtcacctctgtagcttggtgccagtcagactttacaaagattgccacgtgctctgatgacaacaccgtgagagtatggagactgaagagaagtagcgaggactctgcgcagtcggataaaaccgaaactgttggttgggcctgccaaaagaaatgtgtaccgccttctatggccgcaaacctctgtacgcctgggaagccttcaatgataccaagcagttccctgatgtcttccccaacaccagccacgtgtgccccaagttacacgggagacctgccaatgccctccagcactcctgtatctgccttgttgccaattcctaagctgcagactccacaaaggctgaatggcgagggtttaggagcatctcccaaacagacgtcctcttcaaaaatttcaattaaggactggatcacccgcactcccaagtcatccacacgggctgatacaaagacaccctctccccgcaaagccttcacccccgtggagcagtacccaagcgtatcaagtacaagggtacagatgccctatgagaagagggccaagaggcgcctggaaaccagcagcgaagatgtggaacatgtctgccttgaccattgcaactgtgtgatggagttggagcctgggctgaagaaagcaaaactggacttgtgttctttcagtgagaaagagagagacggcagcgatgataaatgcctgaggctttcagacttgagtaggggatttgaccaagaattctctcccggtccgtcaacatccttccttattaatggtacagttaacccccctctaagtcctctgtctgagttgaaaagtgacttgcgagacaaagaaaacagttccccagagaaaaactggctctctgctttagggcacaaattcaagtcggacaagtcttcccctcagaataaagctgccagcagcccctcctctaggaacagcacctctaaaaaacatccgacaaggaatgctcccaattcaccagtatctgtaccaacgacccccggctcaatgagaaaaatctgcacctacttctttaagaaatccgagtaagagtcagcctgtatgttccgcggcgttccgttccacacaaggatgtacatgttgctgcttcgttatttgctccatagagaatgttttatatatttaacattttagcacttttttccatgacataggacactaaatgtgggtttttacaatcaattatttttagtttactaatcgtccaagggaactgcctttaacatcccttacatagggagatctgcccaggagcgaatgttaacaatgtgtttggggaagggtggcaaaaaatctctgtaaatagttttgatattttaatactttatgtgtatgtatagttgagtcatattgtaaaaatataactttttaaatacagattataattcggtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLFRSVVNKPRLGCRQRGVPFTHPLQSLLQCYQCAKHDEHTSYGELGAAVPPFGCAFSTVPDMSHVLAVANEEGIVRLYDTECRDVQRLVVKEFMAHTNAVFDIAWVPGEHKLVTASGDQTAKLWDVKAGDLIGECKGHQCSLKSVAFSKFEKAVFSTGGRDGNIMVWDTRCNKKDGFYRQVNQITGAHNALDKQTPSKVKKRKPYVRGLAPSVDSQQSVTVVIFQDEHTIISAGAVDGIVKVWDLRKNYSAYRQDPVPAKLFPYPGNSTRKLGYSNLVLDPTGTNLFASCTDDNVYMFNATGLKTEPVSVFGGHQNSTFYIKTSVSPDGQFLLSGSSDHSAYIWQVSDPKVPPVTLTGHCQEVTSVAWCQSDFTKIATCSDDNTVRVWRLKRSSEDSAQSDKTETVGWACQKKCVPPSMAANLCTPGKPSMIPSSSLMSSPTPATCAPSYTGDLPMPSSTPVSALLPIPKLQTPQRLNGEGLGASPKQTSSSKISIKDWITRTPKSSTRADTKTPSPRKAFTPVEQYPSVSSTRVQMPYEKRAKRRLETSSEDVEHVCLDHCNCVMELEPGLKKAKLDLCSFSEKERDGSDDKCLRLSDLSRGFDQEFSPGPSTSFLINGTVNPPLSPLSELKSDLRDKENSSPEKNWLSALGHKFKSDKSSPQNKAASSPSSRNSTSKKHPTRNAPNSPVSVPTTPGSMRKICTYFFKKSE
Donor tissue: tailbud