ORFeome > dusp1 – XORFeome 2.0

dusp1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis dual specificity phosphatase 1, mRNA (cDNA clone MGC:69228 IMAGE:5307757), complete cds
Gene Symbol: dusp1
Gene ID: 448043
ORF gb_acc: MG133229
ORF ID: 10700

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074564

Library Location

Plate ID: GDExt11007
Well Location: C02

EST Sequences

Clone: MGC:69228 IMAGE:5307757
Trimmed Sequence: ATGGTCAATATGGAAATCTGCGCTATGGATTGCTGCGTGTTGAAAGGACTGTTAGCTGAGAGAGCCCACAAATGCCTCATATTGGACTGTAGGTCGTTCTTCTCCTTCAGCTCCTCCAACATCATTGGCTCCAGCAATGTTCGCCTGAGCACCATAGTGAAGAGGAGAGCTAAAGGCAGCATGGGCTTGGAGCACATCGTCCCCAATGAGGAGCAGAGGTGCCGGCTGCTGGCTGGGATGTACGAGGCGGTGGTGCTGCTGGATGAGAGGACATCAGAGCTGGACATGCTAAGGAAGGACAGTACCATGATGCTGGCAGTTAATGCCCTATGTAGGGACTCCAGGGGCAGCAGCATCTACTTCCTAAAAGGTGGCTATGAGACATTTTCTTCACAGTGCCCAGAATTCTGCAACAAAAGCTCTCCTCCAGTTTGCCTGAGTTTGCCTCTTAGTACCAACAATGTGCCAGGCAGTGCGGACTCCAATTGCACTCCTTGCGGAACTCCACTCTATGACCAGGGGGGACCAGTGGAGATTCTGCCTTTCCTGTATTTGGGCAGTGCATACCATGCATCAAGAAAAGACATGCTGGACGCCCTTGGCATTACAGCCCTCATCAATGTATCAGCAAACTGTCCCAATCACTTTGAGGGACACTTTCAGTACAAGAGCATTCCCGTGGAAGACAGTCACAAAGCAGACATCAGTTCGTGGTTCAATGAAGCTATTGATTTCATAGACTCAGTAAAAAATTCCGGTGGAAGGGTTTTTGTCCACTGCCAAGCTGGTATATCCCGATCTGCTACCATCTGTCTTGCCTATCTTATGAGAACCAACCGTGTGAAGCTGGATGAAGCATTTGAGTTTGTCAAGCAACGGAGAAGTATAATCTCCCCAAACTTCAGTTTTATGGGACAGCTTCTTCAGTTTGAGTCTCAAGTGCTAGCACCATCATGTTCAGCAGAAGCAGGTAGCCCTACAATATCTGTTCTAGACCGAGGAACATCCACTACCACAGTCTTCAATTTTCCTGTTTCCATACCTGTCCACTCAGGAACAAGCTCTCTCAGTTACCTTCAGAATCCCATCACTACATCGCCAAGCTGCTAA
Full Trace Sequence: gttaataagcttttattggatcaaagaggcgccggagcgtaaaagaagcgggagagtggagcagcctattgttgaggattgttcggcacaataactatggtcaatatggaaatctgcgctatggattgctgcgtgttgaaaggactgttagctgagagagcccacaaatgcctcatattggactgtaggtcgttcttctccttcagctcctccaacatcattggctccagcaatgttcgcctgagcaccatagtgaagaggagagctaaaggcagcatgggcttggagcacatcgtccccaatgaggagcagaggtgccggctgctggctgggatgtacgaggcggtggtgctgctggatgagaggacatcagagctggacatgctaaggaaggacagtaccatgatgctggcagttaatgccctatgtagggactccaggggcagcagcatctacttcctaaaaggtggctatgagacattttcttcacagtgcccagaattctgcaacaaaagctctcctccagtttgcctgagtttgcctcttagtaccaacaatgtgccaggcagtgcggactccaattgcactccttgcggaactccactctatgaccaggggggaccagtggagattctgcctttcctgtatttgggcagtgcataccatgcatcaagaaaagacatgctggacgcccttggcattacagccctcatcaatgtatcagcaaactgtcccaatcactttgagggacactttcagtacaagagcattcccgtggaagacagtcacaaagcagacatcagttcgtggttcaatgaagctattgatttcatagactcagtaaaaaattccggtggaagggtttttgtccactgccaagctggtatatcccgatctgctaccatctgtcttgcctatcttatgagaaccaaccgtgtgaagctggatgaagcatttgagtttgtcaagcaacggagaagtataatctccccaaacttcagttttatgggacagcttcttcagtttgagtctcaagtgctagcaccatcatgttcagcagaagcaggtagccctacaatatctgttctagaccgaggaacatccactaccacagtcttcaattttcctgtttccatacctgtccactcaggaacaagctctctcagttaccttcagaatcccatcactacatcgccaagctgctaaaggtactgagcaaacagacctagactgtagcaaatggacaatttgtgtttttatcaagtgcaataataatatgcaacactcgtattttatgtcccgttgagttaaagaatcaacaagttcttatagccagttgaactggtaaaactacagaaaagcccaaactgacacaacttgttggacaatattttagaggcatatccaaaccactaaggaagtcaagaaaaacaggtcacaattgccttttgtgtttttgtcccatttttatttgtaatcaccctttttgggggtgatttagcagtattttcattcctgaactcctttttttattgttgattgatgaagagaggccgttgcctaaacctgtaagataatatttattctgcaagctgtgtcctgcctaccgaagcctaagatttcagcttttcaacaaagcaaagaagagatacctcagtattttctggtactgtaattcctgtgtgtaattcaagaccagcttcagtttccaaagcactgatgtcaaagcactaggcccgagccttcttcagagtttgctgactattgtatatatgctctgattttatttatgatacaaaataatatatatcttctcccgtgagaagacatttttaatacagaactatgactttttatactgatagaataaattatgatatttgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVNMEICAMDCCVLKGLLAERAHKCLILDCRSFFSFSSSNIIGSSNVRLSTIVKRRAKGSMGLEHIVPNEEQRCRLLAGMYEAVVLLDERTSELDMLRKDSTMMLAVNALCRDSRGSSIYFLKGGYETFSSQCPEFCNKSSPPVCLSLPLSTNNVPGSADSNCTPCGTPLYDQGGPVEILPFLYLGSAYHASRKDMLDALGITALINVSANCPNHFEGHFQYKSIPVEDSHKADISSWFNEAIDFIDSVKNSGGRVFVHCQAGISRSATICLAYLMRTNRVKLDEAFEFVKQRRSIISPNFSFMGQLLQFESQVLAPSCSAEAGSPTISVLDRGTSTTTVFNFPVSIPVHSGTSSLSYLQNPITTSPSC
Donor tissue: gastrula