ORFeome > echs1 – XORFeome 2.0

echs1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis enoyl Coenzyme A hydratase, short chain, 1, mitochondrial, mRNA (cDNA clone MGC:69284 IMAGE:5308457), complete cds
Gene Symbol: echs1
Gene ID: 448019
ORF gb_acc: MG133201
ORF ID: 10665

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074535

Library Location

Plate ID: GDExt11007
Well Location: H02

EST Sequences

Clone: MGC:69284 IMAGE:5308457
Trimmed Sequence: ATGGCGATGGTTAGCTGGGGAATATTTGCTCCTCTAAGTCAGATCCGTCAGTGCCTTCGTAGAGGCTACAGCGCCGGATCAGCTTTTCAATATATACTTGTGGAGAGAAAGGGGCAGCATCATAATGTTGGATTGATCCGTCTGAACCGACCAAAGGCTTTGAATGCACTGTGTGATGGATTGATGACAGAGATCAATCAGGCATTGGATACTTTTGAAGAAGACCCAAACATTGGTGCTATTGTTATTACTGGTAGTGAAAGGGCATTTGCTGCTGGGGCAGATATAAAAGAAATGCAGAACAGGAGTTTCCAGGAGTGCTATGGTGGTAACTTCCTCTCTCATTGGAACCGTGTGTCCTTTGTCAAGAAGCCAGTTATTGCTGCTGTTAACGGATATGCGCTTGGAGGAGGGTGTGAACTTGCCATGATGTGCGACATCATATATGCTGGAGAGAAGGCAGAATTTGGACAGCCAGAGATACTGCTAGGTACCATCCCAGGTGCAGGTGGAACTCAGAGGCTCACAAGGGCTGTTGGCAAGTCCCTGGCAATGGAAATGGTACTTAGCGGTGACCGCATTTCTGCTCAGGAAGCCCAACAAGCAGGGCTTGTGAGCAAAGTTTACCCTGTGGATAGCGTAGTAGATCAGGCTATTATCTGTGGAGAGAAGATTGCTAGAAACTCCAAGCTTATTGTGTCAATTGCAAAGGAGGCTGTCAGTGCAGCTTTTGAGCTGTCTTTGGCAGAAGGCAACAGACTTGAGAAAAGGCTATTTCATTCTACGTTTGCTACAGAGGACCGTAAAGAAGGAATGACAGCTTTTGTGGAGAAGAGAAAAGCAAACTTCACAGATAAATAA
Full Trace Sequence: cagattttctacgcatgagcaacaaattttaagatggcgatggttagctggggaatatttgctcctctaagtcagatccgtcagtgccttcgtagaggctacagcgccggatcagcttttcaatatatacttgtggagagaaaggggcagcatcataatgttggattgatccgtctgaaccgaccaaaggctttgaatgcactgtgtgatggattgatgacagagatcaatcaggcattggatacttttgaagaagacccaaacattggtgctattgttattactggtagtgaaagggcatttgctgctggggcagatataaaagaaatgcagaacaggagtttccaggagtgctatggtggtaacttcctctctcattggaaccgtgtgtcctttgtcaagaagccagttattgctgctgttaacggatatgcgcttggaggagggtgtgaacttgccatgatgtgcgacatcatatatgctggagagaaggcagaatttggacagccagagatactgctaggtaccatcccaggtgcaggtggaactcagaggctcacaagggctgttggcaagtccctggcaatggaaatggtacttagcggtgaccgcatttctgctcaggaagcccaacaagcagggcttgtgagcaaagtttaccctgtggatagcgtagtagatcaggctattatctgtggagagaagattgctagaaactccaagcttattgtgtcaattgcaaaggaggctgtcagtgcagcttttgagctgtctttggcagaaggcaacagacttgagaaaaggctatttcattctacgtttgctacagaggaccgtaaagaaggaatgacagcttttgtggagaagagaaaagcaaacttcacagataaataaaaattcaactgatctctgtttctacaactgagcacgcagatatttatagcaaatatctgcataaatcactgaaaaattttcactaggatcaaaacaacatatttttcctaaaaatttacccattacacattacgtggttgatgttcttaatagctgacggtttattgggaaaatgacagcaaattctatgtgggaaaaattcagatttttttcttcaataaaagactaagcaatatttatacatttaattttgtcatgattttattaagatttattgttaaagtacttcttagtacacaatgcattaccaaaccccagggtagttacaggattcctgtctagacttaggggcctatttattatgctgtttaaaatgaaattcgccaaaaaacggtgtaaaaagctgtgtacaataaatggagaagttgccgtcaagaaaaaaataaaaaaaaaaaaaaaa
Translation: MAMVSWGIFAPLSQIRQCLRRGYSAGSAFQYILVERKGQHHNVGLIRLNRPKALNALCDGLMTEINQALDTFEEDPNIGAIVITGSERAFAAGADIKEMQNRSFQECYGGNFLSHWNRVSFVKKPVIAAVNGYALGGGCELAMMCDIIYAGEKAEFGQPEILLGTIPGAGGTQRLTRAVGKSLAMEMVLSGDRISAQEAQQAGLVSKVYPVDSVVDQAIICGEKIARNSKLIVSIAKEAVSAAFELSLAEGNRLEKRLFHSTFATEDRKEGMTAFVEKRKANFTDK
Donor tissue: gastrula