ORFeome > edar – XORFeome 2.0

edar – XORFeome 2.0

General Information

Species: Xenopus tropicalis ectodysplasin A receptor, mRNA (cDNA clone MGC:88893 IMAGE:6998530), complete cds
Gene Symbol: edar
Gene ID: 448544
ORF gb_acc: MG134074
ORF ID: 11698

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076874

Library Location

Plate ID: GDExt11016
Well Location: D10

EST Sequences

Clone: MGC:88893 IMAGE:6998530
Trimmed Sequence: ATGAACCAATCAAGTGACAGAAAATGGACCCATATATTCCGCTTTATAATGGTGTCCCTGTTGTGCTCTGTGCATGCAGATTATGGGAACTGTGGGGAAAATGAATATTATAATCAGACGACTGGCATGTGCCAAAGCTGCCCTGAATGTGAGCCTGGGGAAGAACCATATATGACCTGTGGTTATGGCTTTAAAGATGAAGACTTTGGCTGTGTTCCTTGCCAGTCTGGCAAATATTCAAAAGGAGGCTACCAGATTTGCAGAAGGCACAAAGATTGCGAGGGGTTTTTCCGCGCTACTGTCCTAACTGCAGGGGACAGTGAGAATGATGCAGAATGTGGACCATGTCTTCCTGGGTACTACATGTTGGAGAACCGTCCCAAGAGCATGTATGGAAATGTTTGCTACTCCTGTCTGTCTGCGCCTCCAAACACCAAGGAATGTATTGGATTATCAGCCCCTATTTCTGGCAGCTCCACAAGTACAACAGGCTCAAGCACCATCTCCCCTTTCCAACATCCACACAAAGTAGAAGTGTCTGGACAAGGACATTTGGCCACGGCTCTGATTATTGCAATGTCAACAATATTCATCATGGCCATAGCCATTGTTCTCATCATCATGTTCTACATTTTAAAGACCAAGCCTTCTTCTCAAGCATGTTGCACCGGCCCTTCAAAGAATGTGGAAGCTCAGATCAACCAACAGGAAGAGAAAAAGGAGGTGCCAGCTGAAAATATCTTTTCTGAAAAAGATGAATTTGAAAAATTGTCCGAGACCCAGACTAAAACAGAAAAAAATGAAAATGATGCCTCGTCAGAGAATGAGCGTCTTTTAAGCCGTAGCATGGACAGCGATGAAGAGGCAGCCATTGACAAACAAGGGAGCGCGGAGCTCTGCCTCTTATCATTAGTGCACCTGGCAAGGGACAAATCCACCACAAACAGCAAATTAACTGGGATCCACAGTCGGAGGAAAAAGATACTGGACCTTTATGCCAGTGTATGTAATGTTGCAGAAGGTCTCAGCCCTACAGAACTGCCGTTTGACTGCCTAGAAAAGACCAGCAGAATGCTTAGTTCTACATACAATACAGAAAAAGCAATAGTCAAAACATGGCGTCACCTTGCTGAGAGCTTTGGCTTGAAAAGGGATGAAATTGGTGGAATGACAGATGGACTTCAGCTCTTTGATCGCATCAGCACTGCTGGATACAGCATACCAGACCTGCTTACTAGGCTGGTACAGATTGAGAGACTGGATGCTGTGGAATCCCTGTGCACAGACATTGTAGAGTGGGCACAAGGAACACCCACATTAAACCCACCTTCTTTACCCAAAAATGAAAGCTCGTGA
Full Trace Sequence: ccagggaagagtgcacatgtaccagctctggctgtgactgagtggcagatgacaaggtcccatttagccttggagtgagccatgaagtttctacttattagctggatttccctggactgactgatttccttttaactgcattagtgtggagcacatcattcaggcctcaagtgcaaaaccccagaaaagcatgaaccaatcaagtgacagaaaatggacccatatattccgctttataatggtgtccctgttgtgctctgtgcatgcagattatgggaactgtggggaaaatgaatattataatcagacgactggcatgtgccaaagctgccctgaatgtgagcctggggaagaaccatatatgacctgtggttatggctttaaagatgaagactttggctgtgttccttgccagtctggcaaatattcaaaaggaggctaccagatttgcagaaggcacaaagattgcgaggggtttttccgcgctactgtcctaactgcaggggacagtgagaatgatgcagaatgtggaccatgtcttcctgggtactacatgttggagaaccgtcccaagagcatgtatggaaatgtttgctactcctgtctgtctgcgcctccaaacaccaaggaatgtattggattatcagcccctatttctggcagctccacaagtacaacaggctcaagcaccatctcccctttccaacatccacacaaagtagaagtgtctggacaaggacatttggccacggctctgattattgcaatgtcaacaatattcatcatggccatagccattgttctcatcatcatgttctacattttaaagaccaagccttcttctcaagcatgttgcaccggcccttcaaagaatgtggaagctcagatcaaccaacaggaagagaaaaaggaggtgccagctgaaaatatcttttctgaaaaagatgaatttgaaaaattgtccgagacccagactaaaacagaaaaaaatgaaaatgatgcctcgtcagagaatgagcgtcttttaagccgtagcatggacagcgatgaagaggcagccattgacaaacaagggagcgcggagctctgcctcttatcattagtgcacctggcaagggacaaatccaccacaaacagcaaattaactgggatccacagtcggaggaaaaagatactggacctttatgccagtgtatgtaatgttgcagaaggtctcagccctacagaactgccgtttgactgcctagaaaagaccagcagaatgcttagttctacatacaatacagaaaaagcaatagtcaaaacatggcgtcaccttgctgagagctttggcttgaaaagggatgaaattggtggaatgacagatggacttcagctctttgatcgcatcagcactgctggatacagcataccagacctgcttactaggctggtacagattgagagactggatgctgtggaatccctgtgcacagacattgtagagtgggcacaaggaacacccacattaaacccaccttctttacccaaaaatgaaagctcgtgaactgagactggacacgtaaagtccttttgtattgaggacatgcataaggttacacaatgagcaccctgtacaatctagcaatcctaaatcatttcagaatagaggaatatttgcttttcctgtataaagatgcacactgaacatactggagatgccacagttggatatccagcagtattaaacacatgtagcactgagaaggatgattctcacgtagagaatgcaaatggaatagcatatttcctaaaaagacaactgaattatggacaacatattcaaaaaataagtgcatggtggaaattggtctaatttttttcaagaaacattttcttttcccatctagtgtataaatcatatatcaaacgctacagtagtttctgttagccttgaaagaaatgaaatgtggcatttttgctgctgaagaatccaccaaaaagaaagacattctggaccagcatataaagtaatatggactccatgggtgcagatattgctaaacatactaacacatgaacacttttgaaactgttgtactttgtcttgaatgattctgtctttgcagtttaggaaaggctttacaacatgggatttttgctatctgggcaaacagagaagagaatcatgaaatgacttataataactaagtgaccagaagccacaattttgttataaaaattctctgtgcagaatctgtaaaactgtgcacttttctccattagtgttcaaatgatttctacccaagaacatttcttagtgaagtatgcttagtacagccaatacctattacctgcattataagattcacttgttgagccaatcaatgagccaatgcggtccatgatcttaataaaaaaaaatcaaacctgacttgattttcagccagatattggttgagttgggccgttgggggtcgccatacatggggtgtcgaattggtctaaaggacttaaattggcagcttaaatctgcctgtgtatggctactgtaagccctgaacaatctataaacaaactttggcagttatttctgctaatatttgcttgacaaatgactgtgcatctttgtcactaggggcatttatctaaagctgtgtaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNQSSDRKWTHIFRFIMVSLLCSVHADYGNCGENEYYNQTTGMCQSCPECEPGEEPYMTCGYGFKDEDFGCVPCQSGKYSKGGYQICRRHKDCEGFFRATVLTAGDSENDAECGPCLPGYYMLENRPKSMYGNVCYSCLSAPPNTKECIGLSAPISGSSTSTTGSSTISPFQHPHKVEVSGQGHLATALIIAMSTIFIMAIAIVLIIMFYILKTKPSSQACCTGPSKNVEAQINQQEEKKEVPAENIFSEKDEFEKLSETQTKTEKNENDASSENERLLSRSMDSDEEAAIDKQGSAELCLLSLVHLARDKSTTNSKLTGIHSRRKKILDLYASVCNVAEGLSPTELPFDCLEKTSRMLSSTYNTEKAIVKTWRHLAESFGLKRDEIGGMTDGLQLFDRISTAGYSIPDLLTRLVQIERLDAVESLCTDIVEWAQGTPTLNPPSLPKNESS
Donor tissue: