ORFeome > eef1a1o – XORFeome 2.0

eef1a1o – XORFeome 2.0

General Information

Species: Xenopus tropicalis eukaryotic translation elongation factor 1 alpha 1, oocyte form, mRNA (cDNA clone MGC:75658 IMAGE:5379772), complete cds
Gene Symbol: eef1a1o
Gene ID: 394920
ORF gb_acc: MG132852
ORF ID: 10205

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064177

Library Location

Plate ID: GDExt11002
Well Location: H10

EST Sequences

Clone: MGC:75658 IMAGE:5379772
Trimmed Sequence: ATGGGAAAGGAAAAGATTCACATTAACATCGTTGTGATCGGGCATGTGGACTCTGGCAAGTCAACCACAACCGGGCATCTCATCTACAAATGCGGGGGCATTGACAAAAGGACCATCGAAAAGTTTGAGAAGGAAGCTGCAGAGATGGGTAAAGGCTCCTTTAAATATGCTTGGGTCTTGGATAAGCTGAAAGCCGAGAGAGAACGTGGCATAACCATTGATATTTCCTTGTGGAAGTTCGAGACTGGAAAATTCTATATCACAATTATTGATGCTCCTGGGCACAGAGACTTCATCAAAAACATGATCACTGGCACTTCTCAGGCTGACTGTGCAGTGCTCATTGTTGCTGGTGGTGTTGGAGAATTTGAGGCTGGTATCTCTAAAAATGGACAGACTCGAGAGCATGCCCTCTTAGCTTTCACTCTAGGTGTCAAGCAGCTTATAATTGGAGTAAACAAGATGGACTCCACTGAGCCCCCTTTCAGCCAAAAAAGATTTGAGGAAATTACTAAAGAAGTCAGTGCCTACATTAAGAAGATTGGCTACAACCCAGCGACTGTTCCATTTGTGCCGATATCTGGATGGCATGGAGACAACATGCTGGAGGCTAGCACCAATATGCCCTGGTTTAAAGGCTGGAAGATTGAAAGGAAAGAAGGAAATGCCAGTGGTGTGACATTGCTAGAAGCACTTGATTGCATTATTCCTCCTCAGCGACCCACTGACAAGCCTCTAAGGCTCCCTCTGCAGGATGTGTACAAGATTGGTGGAATTGGCACTGTGCCTGTTGGCAGAGTGGAGACTGGTGTCTTGAAGCCTGGCATGGTTGTGACTTTTGCACCTAGTAATGTTACTACAGAAGTTAAGTCTGTGGAAATGCATCATGAGGCCTTGCAAGAGGCATTGCCTGGAGACAATGTGGGCTTTAATGTAAAGAATATATCTGTGAAGGACATCAGGAGAGGCAATGTGGCTGGTGATAGCAAAAATGATCCACCTATGCAAGCTGGAACCTTTACAGCACAGGTAATTATACTCAATCACCCAGGACAGATTAGTGCTGGCTATGCTCCAGTCCTGGACTGCCATACAGCTCATATTGCCTGTAAATTTGCTGAGCTGAAGCAAAAGATAGACAGAAGAAGTGGCAAGAAGCTGGAGGATGACCCAAAATTCTTGAAATCTGGAGATGCAGCTATAGTGGAAATGATTCCTGGGAAGCCCATGTGTGTAGAAACCTTCTCAGACTACCCACCCCTTGGCCGATTTGCAGTGCGTGACATGAGGCAGACGGTAGCTGTTGGCGTAATCAAAGGTGTGGATAAAAAGGCAGCAAGCTCTGGAAAAGTGACTAAGTCTGCTGTAAAAGCTGGCAAGAAATGA
Full Trace Sequence: agcgcagcaattcctcgcagtctctgcctgctctgctgtatttgttcgtgggggttgactggtggtcgctgccaagatgggaaaggaaaagattcacattaacatcgttgtgatcgggcatgtggactctggcaagtcaaccacaaccgggcatctcatctacaaatgcgggggcattgacaaaaggaccatcgaaaagtttgagaaggaagctgcagagatgggtaaaggctcctttaaatatgcttgggtcttggataagctgaaagccgagagagaacgtggcataaccattgatatttccttgtggaagttcgagactggaaaattctatatcacaattattgatgctcctgggcacagagacttcatcaaaaacatgatcactggcacttctcaggctgactgtgcagtgctcattgttgctggtggtgttggagaatttgaggctggtatctctaaaaatggacagactcgagagcatgccctcttagctttcactctaggtgtcaagcagcttataattggagtaaacaagatggactccactgagccccctttcagccaaaaaagatttgaggaaattactaaagaagtcagtgcctacattaagaagattggctacaacccagcgactgttccatttgtgccgatatctggatggcatggagacaacatgctggaggctagcaccaatatgccctggtttaaaggctggaagattgaaaggaaagaaggaaatgccagtggtgtgacattgctagaagcacttgattgcattattcctcctcagcgacccactgacaagcctctaaggctccctctgcaggatgtgtacaagattggtggaattggcactgtgcctgttggcagagtggagactggtgtcttgaagcctggcatggttgtgacttttgcacctagtaatgttactacagaagttaagtctgtggaaatgcatcatgaggccttgcaagaggcattgcctggagacaatgtgggctttaatgtaaagaatatatctgtgaaggacatcaggagaggcaatgtggctggtgatagcaaaaatgatccacctatgcaagctggaacctttacagcacaggtaattatactcaatcacccaggacagattagtgctggctatgctccagtcctggactgccatacagctcatattgcctgtaaatttgctgagctgaagcaaaagatagacagaagaagtggcaagaagctggaggatgacccaaaattcttgaaatctggagatgcagctatagtggaaatgattcctgggaagcccatgtgtgtagaaaccttctcagactacccaccccttggccgatttgcagtgcgtgacatgaggcagacggtagctgttggcgtaatcaaaggtgtggataaaaaggcagcaagctctggaaaagtgactaagtctgctgtaaaagctggcaagaaatgatctgtgtaaccctgtacagtgtaatcttggtgtcctgtaaaaatgaataaatgtttaatgatgcctttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGKEKIHINIVVIGHVDSGKSTTTGHLIYKCGGIDKRTIEKFEKEAAEMGKGSFKYAWVLDKLKAERERGITIDISLWKFETGKFYITIIDAPGHRDFIKNMITGTSQADCAVLIVAGGVGEFEAGISKNGQTREHALLAFTLGVKQLIIGVNKMDSTEPPFSQKRFEEITKEVSAYIKKIGYNPATVPFVPISGWHGDNMLEASTNMPWFKGWKIERKEGNASGVTLLEALDCIIPPQRPTDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMVVTFAPSNVTTEVKSVEMHHEALQEALPGDNVGFNVKNISVKDIRRGNVAGDSKNDPPMQAGTFTAQVIILNHPGQISAGYAPVLDCHTAHIACKFAELKQKIDRRSGKKLEDDPKFLKSGDAAIVEMIPGKPMCVETFSDYPPLGRFAVRDMRQTVAVGVIKGVDKKAASSGKVTKSAVKAGKK
Donor tissue: tadpole