ORFeome > eef2 – XORFeome 2.0

eef2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis eukaryotic translation elongation factor 2, mRNA (cDNA clone MGC:76191 IMAGE:5335874), complete cds
Gene Symbol: eef2
Gene ID: 394866
ORF gb_acc: MG132706
ORF ID: 9997

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063919

Library Location

Plate ID: GDExt11001
Well Location: C01

EST Sequences

Clone: MGC:76191 IMAGE:5335874
Trimmed Sequence: ATGGTGAACTTCACGGTAGACCAGATTCGTTCCATCATGGACAAGAAGGCGAACATTCGTAATATGTCGGTCATTGCCCATGTGGACCACGGTAAATCTACTCTGACTGACTCACTGGTATGCAAGGCTGGTATCATTGCTTCTGCTAGGGCTGGTGAGACTCGTTTTACAGATACCAGAAAAGATGAACAAGAGAGATGTATCACCATCAAATCAACAGCAATCTCTCTCTTCTATGAGCTCTCTGAGAACGATTTGGCTTTTATCAAGCAAAGCAAAGATGGGTGTGGCTTCCTTATAAACTTGATTGACTCCCCTGGCCATGTAGACTTTTCCTCTGAAGTAACTGCTGCTCTTCGTGTCACAGATGGTGCCTTAGTTGTAGTGGACTGTGTTTCAGGCGTCTGTGTGCAGACTGAAACCGTGCTTCGTCAAGCCATTGCAGAGCGCATCCGCCCTGTGTTGATGATGAACAAAATGGATCGTGCTCTTTTGGAGCTGCAGTTGGAACCAGAGGAGCTCTACCAAACTTTTCAGCGCATTGTGGAGAATGTTAATGTGATTATTTCCACCTACGGTGAAGGAGAGACTGGACCCATGGGAAATATCATGATTGACCCTGTTCTTGGCACAGTTGGTTTTGGCTCTGGTCTGCATGGCTGGGCTTTCACACTAAAACAGTTTGCAGAGATGTATGTCGCAAAATTTGCAGCAAAGGGGGAAGGTCAGTTGGCTCCTGCAGAACGGGCCAAAAAAGTGGAGGACATGATGAAGAAGCTGTGGGGTGATAGGTATTTTGACCCTGCAAATGGAAAGTTCAGCAAGTCTGCAACAAACGCTGATGGCAAAAAACTTCCTAGAACCTTCTGCCAGCTTGTATTGGATCCAATTTTCAAGGTATTTGATGCAATCATGAATTTTAAGAAAGAAGAAACTGCCAAATTGGTCGAGAAACTAGACATCAAACTTGACAGTGAGGACAAAGACAAAGAGGGAAAACAGTTGCTTAAGGCTGTTATGAGACGCTGGCTCCCAGCTGGAGAGGCTCTTCTGCAGATGATTACCATCCACTTGCCCTCACCAGTGACTGCTCAGAAATACCGTTGTGAGCTGTTGTATGAGGGTCCCCCAGATGATGAAGCTGCCATGGGTATCAAGAACTGTGACCCCAAAGGCCCTCTTATGATGTACATCTCAAAAATGGTGCCCACCACTGACAAGGGTAGATTTTATGCCTTTGGAAGAGTTTTCTCAGGTGTAGTCTCCACTGGCCTCAAAGTCAGGATAATGGGACCAAACTTCACTCCAGGCAAGAAGGAGGACCTTTACCTAAAACCCATTCAGAGGACCATTCTGATGATGGGAAGATATGTGGAACCCATTGAGGATGTGCCATGTGGAAACATTGTTGGTTTAGTTGGAGTAGATCAGTTCCTGGTTAAGACTGGAACAATCACTACCTTTGAACATTCACATAACATGCGTGTTATGAAGTTTAGTGTCAGCCCTGTTGTGCGTGTTGCTGTGGAAGCAAAGAATCCTGCTGATCTCCCTAAGTTGGTTGAGGGTCTGAAACGTCTAGCTAAATCAGACCCCATGGTTCAGTGCATCATTGAAGAATCTGGCGAGCATATCATTGCTGGAGCTGGGGAGCTGCATTTGGAGATTTGCCTGAAGGATCTTGAGGAGGATCATGCCTGCATTCCAATAAAGAAATCTGATCCAGTCGTATCTTACCGTGAGACTGTGAGCGAGGAGTCCAACCAGATGTGCCTGTCAAAGTCTCCTAACAAGCACAACCGTCTGTTTATGAAGTGTCGACCTTTTCCTGATGGTCTTGCTGAAGACATTGATAAAGGTGATGTATCTGCTCGCCAGGAGTTGAAGACTCGTGCCCGCTACTTGGCTGAAAAGTACGAATGGGATGTGACTGAAGCTAGGAAGATTTGGTGTTTTGGTCCTGATGGCTCTGGGCCCAACATACTTACTGATGTTACTAAGGGAGTTCAGTATCTGAATGAAATCAAAGACAGCGTTGTTGCAGGATTCCAGTGGGCTACAAAGGAGGGTGTCCTGTGTGAAGAAAATTTGAGAGGTGTTCGTTTTGATGTCCATGATGTAACACTTCATGCTGATGCCATCCATAGAGGAGGAGGACAGATCATTCCAACTGCACGCCGCGTCTTGTATGCTTGTGTGTTGACTGCTCAGCCACGTCTGATGGAACCAATCTACCTTGTTGAAATTCAGTGCCCTGAGCAGGTGGTAGGAGGTATCTATGGTGTCTTGAACAGAAAGCGTGGGCATGTCTTTGAAGAATCCCAGGTGGCTGGAACACCAATGTTTGTGGTTAAGGCATACCTGCCTGTAAATGAGTCATTTGGTTTCACTGCTGACTTAAGATCAAACACTGGTGGCCAGGCCTTCCCTCAGTGTGTGTTTGACCACTGGCAAATTCTACCTGGAGATCCTTTCGATAACACCACCAGGCCTTTCCAAGTGGTGGCAGAGACCCGGAAGAGGAAGGGCTTGAAAGAGGGTGTTCAAGCCTTGGATAACTTCCTTGACAAGCTGTAA
Full Trace Sequence: ccgccattgcccctatatattgcgaaccgttgacgtcagcggtctcttccgcctgtttgtctgctgtgaggcagactgtccgtatcggcctaagcccgtcccgtgaagagaatccaccgccatctgccacaatggtgaacttcacggtagaccagattcgttccatcatggacaagaaggcgaacattcgtaatatgtcggtcattgcccatgtggaccacggtaaatctactctgactgactcactggtatgcaaggctggtatcattgcttctgctagggctggtgagactcgttttacagataccagaaaagatgaacaagagagatgtatcaccatcaaatcaacagcaatctctctcttctatgagctctctgagaacgatttggcttttatcaagcaaagcaaagatgggtgtggcttccttataaacttgattgactcccctggccatgtagacttttcctctgaagtaactgctgctcttcgtgtcacagatggtgccttagttgtagtggactgtgtttcaggcgtctgtgtgcagactgaaaccgtgcttcgtcaagccattgcagagcgcatccgccctgtgttgatgatgaacaaaatggatcgtgctcttttggagctgcagttggaaccagaggagctctaccaaacttttcagcgcattgtggagaatgttaatgtgattatttccacctacggtgaaggagagactggacccatgggaaatatcatgattgaccctgttcttggcacagttggttttggctctggtctgcatggctgggctttcacactaaaacagtttgcagagatgtatgtcgcaaaatttgcagcaaagggggaaggtcagttggctcctgcagaacgggccaaaaaagtggaggacatgatgaagaagctgtggggtgataggtattttgaccctgcaaatggaaagttcagcaagtctgcaacaaacgctgatggcaaaaaacttcctagaaccttctgccagcttgtattggatccaattttcaaggtatttgatgcaatcatgaattttaagaaagaagaaactgccaaattggtcgagaaactagacatcaaacttgacagtgaggacaaagacaaagagggaaaacagttgcttaaggctgttatgagacgctggctcccagctggagaggctcttctgcagatgattaccatccacttgccctcaccagtgactgctcagaaataccgttgtgagctgttgtatgagggtcccccagatgatgaagctgccatgggtatcaagaactgtgaccccaaaggccctcttatgatgtacatctcaaaaatggtgcccaccactgacaagggtagattttatgcctttggaagagttttctcaggtgtagtctccactggcctcaaagtcaggataatgggaccaaacttcactccaggcaagaaggaggacctttacctaaaacccattcagaggaccattctgatgatgggaagatatgtggaacccattgaggatgtgccatgtggaaacattgttggtttagttggagtagatcagttcctggttaagactggaacaatcactacctttgaacattcacataacatgcgtgttatgaagtttagtgtcagccctgttgtgcgtgttgctgtggaagcaaagaatcctgctgatctccctaagttggttgagggtctgaaacgtctagctaaatcagaccccatggttcagtgcatcattgaagaatctggcgagcatatcattgctggagctggggagctgcatttggagatttgcctgaaggatcttgaggaggatcatgcctgcattccaataaagaaatctgatccagtcgtatcttaccgtgagactgtgagcgaggagtccaaccagatgtgcctgtcaaagtctcctaacaagcacaaccgtctgtttatgaagtgtcgaccttttcctgatggtcttgctgaagacattgataaaggtgatgtatctgctcgccaggagttgaagactcgtgcccgctacttggctgaaaagtacgaatgggatgtgactgaagctaggaagatttggtgttttggtcctgatggctctgggcccaacatacttactgatgttactaagggagttcagtatctgaatgaaatcaaagacagcgttgttgcaggattccagtgggctacaaaggagggtgtcctgtgtgaagaaaatttgagaggtgttcgttttgatgtccatgatgtaacacttcatgctgatgccatccatagaggaggaggacagatcattccaactgcacgccgcgtcttgtatgcttgtgtgttgactgctcagccacgtctgatggaaccaatctaccttgttgaaattcagtgccctgagcaggtggtaggaggtatctatggtgtcttgaacagaaagcgtgggcatgtctttgaagaatcccaggtggctggaacaccaatgtttgtggttaaggcatacctgcctgtaaatgagtcatttggtttcactgctgacttaagatcaaacactggtggccaggccttccctcagtgtgtgtttgaccactggcaaattctacctggagatcctttcgataacaccaccaggcctttccaagtggtggcagagacccggaagaggaagggcttgaaagagggtgttcaagccttggataacttccttgacaagctgtaaacctttgctttactcctgtcagcattgattaagtggaaatgaactatacccaaaagatgtcagcattccctgcaacattctgttggaaccctgaatataatctttcattggcatgatcataactttctatttattcttgatgggtagcttctgctctctgaaaacatcttggatggctggggaagtaaatgtgaatttgagggttgacaggaacgagggcagaatgtagagcaaagatgtactgcaataaccttgaatgacttattggtgccattaaaaaaatttaattgaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVNFTVDQIRSIMDKKANIRNMSVIAHVDHGKSTLTDSLVCKAGIIASARAGETRFTDTRKDEQERCITIKSTAISLFYELSENDLAFIKQSKDGCGFLINLIDSPGHVDFSSEVTAALRVTDGALVVVDCVSGVCVQTETVLRQAIAERIRPVLMMNKMDRALLELQLEPEELYQTFQRIVENVNVIISTYGEGETGPMGNIMIDPVLGTVGFGSGLHGWAFTLKQFAEMYVAKFAAKGEGQLAPAERAKKVEDMMKKLWGDRYFDPANGKFSKSATNADGKKLPRTFCQLVLDPIFKVFDAIMNFKKEETAKLVEKLDIKLDSEDKDKEGKQLLKAVMRRWLPAGEALLQMITIHLPSPVTAQKYRCELLYEGPPDDEAAMGIKNCDPKGPLMMYISKMVPTTDKGRFYAFGRVFSGVVSTGLKVRIMGPNFTPGKKEDLYLKPIQRTILMMGRYVEPIEDVPCGNIVGLVGVDQFLVKTGTITTFEHSHNMRVMKFSVSPVVRVAVEAKNPADLPKLVEGLKRLAKSDPMVQCIIEESGEHIIAGAGELHLEICLKDLEEDHACIPIKKSDPVVSYRETVSEESNQMCLSKSPNKHNRLFMKCRPFPDGLAEDIDKGDVSARQELKTRARYLAEKYEWDVTEARKIWCFGPDGSGPNILTDVTKGVQYLNEIKDSVVAGFQWATKEGVLCEENLRGVRFDVHDVTLHADAIHRGGGQIIPTARRVLYACVLTAQPRLMEPIYLVEIQCPEQVVGGIYGVLNRKRGHVFEESQVAGTPMFVVKAYLPVNESFGFTADLRSNTGGQAFPQCVFDHWQILPGDPFDNTTRPFQVVAETRKRKGLKEGVQALDNFLDKL
Donor tissue: tailbud