ORFeome > efhc1 – XORFeome 2.0

efhc1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis EFHC1, mRNA (cDNA clone MGC:89313 IMAGE:6986568), complete cds
Gene Symbol: efhc1
Gene ID: 493468
ORF gb_acc: MG133809
ORF ID: 11382

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC081308

Library Location

Plate ID: GDExt11013
Well Location: F08

EST Sequences

Clone: MGC:89313 IMAGE:6986568
Trimmed Sequence: ATGGCTTCTTATCCCGTGCACGGACTGCCCTTCCTGCCTGGGAACACCTACAGGGACCCCACGAAAAGCGCATTTCACCGCTCCCAGACCTTAACCTACAAAAACGGTTACAGTCGACCCATTCTCCCCACTGTCGGCATCGGACGGGAACCCATCACAGCCAACCAGCTGTCCCAAGCTGAACTAGATGAGCTGGCCAACAAAAGGCCAACACTGACCTATGGGCGTGCCAAGCCGGCCCCACCATCAGATTTCATCCCTTCCTATGTGGCCTTTGATAAAAAGGTGCTCAGGTTTGAGGGTTACTTCCAAGAGACTGTCCCCCTGTCCCCGGAGGAGCACTACCGAGTGCGCAGAGTCACGCTGTATTACTATCTGGAAGATGACACTATATCAGTGATAGAGCCACCTATGGAAAATTCCGGCATCCCCCAAGGAACATTTATCAAGCGCCAAAGACACCCCAAGAATGCAAACGGGGATCCCTATCACTGGAAGGATCTAAATGTGGGGATCAACGTCACTTTGTACGGCCGAACCTTCCGCCTTATCAGCTGTGACAGTTTCACTCAGGAATTCCTGGAGAGCGAGGGCATCGAGCTGAACCCCCCAGAGGGCATCCCTACAGACCCATTTACTGAACTGAGGAGGAGGCCCAATCGCACATTCGTCACCCCATCCGACTTCGATAAGCTCAAGCAGTACCTCACTATGGACCGTAAGGTTCTGCGCTTCTTTGCTGTGTGGGACGACACGGAGAGCATGTTTGGAGAGAAGCACCCGGTGCTCATTCACTACTACCTGTCTGACGACACAGTGGAAATCAGGGAAGTGCATGAGCGAAACGATGGACGCGACCCATTCCCAGTGTTGATGAAACGCCAACACTTACCTAAAGTGGTGAATGATACAAAAGACACCTTCCCAATGTGTGTGCTGGAGATCTCAGACCAAGAGGTGAAGGAATGGTTTTCCCCTGGAGATTTCAAAGTAGGAAAGCACATTAGTATTCTAGGACGCAAGTTCTTTATCTATGACTGTGATGCCTACACTCGAGACTTCTACAGAGATAAAATGGGGATCGGAGACCTTCAGCCTGTTGAGGTTAACAAGGAGAGAGAAGATGAGGAAGAGAAGGTCATCCAGGAGATCCCTCCATACAATGGATTTGGTTTGCTCGAAGACTCTTTACAGAACTGCCTATCCCTGGTTCCCAAGCCCCCCAAAAAGGATGTGCTGAAAATGCTGGAGAATGACCATAATGTCCTGAGATACGTAGTTATTCTGGATTCCCCAAACCCAGAAGACAAAGTGCGGCGCTTCGTCCTCTCATACTTCTTGGCCAACGACATGCTGAGCATCTTTGAGCGCCAAGTTCGGAACTCTGGTATCATCGGGGGGAAATTCCTAGAGAAATCCAGGGTGCTGGTACCGGGTTCCACCGTAGACAACCCTATCTACTATGGACCGAAGGACTTCACTATTGGGGCTGCTATTGAAGTCTTCAACCACAGATTTATCATCACAGACGCCGACGAATACGTATTAAACTACATGAAGGCGCACAGCAAGGAGTTCCCCCCCCATGTGTTACATTCCCTGGAAAGGCACCTGTACCCCCAGCCGGAGATATAA
Full Trace Sequence: gggagctgtgtggggagacagtgaagggacagacagggactgacaggctttagggatacagggagacggggggagagtcccacacaggggaacacagggagcccaacggaaaggcagagagagagtgtgggccccccagcagggaccagtttaagcagaaagtttgaggggagctcccccctatttactgggcgccatggcttcttatcccgtgcacggactgcccttcctgcctgggaacacctacagggaccccacgaaaagcgcatttcaccgctcccagaccttaacctacaaaaacggttacagtcgacccattctccccactgtcggcatcggacgggaacccatcacagccaaccagctgtcccaagctgaactagatgagctggccaacaaaaggccaacactgacctatgggcgtgccaagccggccccaccatcagatttcatcccttcctatgtggcctttgataaaaaggtgctcaggtttgagggttacttccaagagactgtccccctgtccccggaggagcactaccgagtgcgcagagtcacgctgtattactatctggaagatgacactatatcagtgatagagccacctatggaaaattccggcatcccccaaggaacatttatcaagcgccaaagacaccccaagaatgcaaacggggatccctatcactggaaggatctaaatgtggggatcaacgtcactttgtacggccgaaccttccgccttatcagctgtgacagtttcactcaggaattcctggagagcgagggcatcgagctgaaccccccagagggcatccctacagacccatttactgaactgaggaggaggcccaatcgcacattcgtcaccccatccgacttcgataagctcaagcagtacctcactatggaccgtaaggttctgcgcttctttgctgtgtgggacgacacggagagcatgtttggagagaagcacccggtgctcattcactactacctgtctgacgacacagtggaaatcagggaagtgcatgagcgaaacgatggacgcgacccattcccagtgttgatgaaacgccaacacttacctaaagtggtgaatgatacaaaagacaccttcccaatgtgtgtgctggagatctcagaccaagaggtgaaggaatggttttcccctggagatttcaaagtaggaaagcacattagtattctaggacgcaagttctttatctatgactgtgatgcctacactcgagacttctacagagataaaatggggatcggagaccttcagcctgttgaggttaacaaggagagagaagatgaggaagagaaggtcatccaggagatccctccatacaatggatttggtttgctcgaagactctttacagaactgcctatccctggttcccaagccccccaaaaaggatgtgctgaaaatgctggagaatgaccataatgtcctgagatacgtagttattctggattccccaaacccagaagacaaagtgcggcgcttcgtcctctcatacttcttggccaacgacatgctgagcatctttgagcgccaagttcggaactctggtatcatcggggggaaattcctagagaaatccagggtgctggtaccgggttccaccgtagacaaccctatctactatggaccgaaggacttcactattggggctgctattgaagtcttcaaccacagatttatcatcacagacgccgacgaatacgtattaaactacatgaaggcgcacagcaaggagttccccccccatgtgttacattccctggaaaggcacctgtacccccagccggagatataatgccaagtggatccatggtggggaggccaacatctcactgaagaactggctcaaagcctccagacgctgcttattgggaagtcatcatcctagaggccaaatgattggattggattgggttgggttggtcagtgcgctgcatgaatttgcttatattaaaccaatgcctgagaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASYPVHGLPFLPGNTYRDPTKSAFHRSQTLTYKNGYSRPILPTVGIGREPITANQLSQAELDELANKRPTLTYGRAKPAPPSDFIPSYVAFDKKVLRFEGYFQETVPLSPEEHYRVRRVTLYYYLEDDTISVIEPPMENSGIPQGTFIKRQRHPKNANGDPYHWKDLNVGINVTLYGRTFRLISCDSFTQEFLESEGIELNPPEGIPTDPFTELRRRPNRTFVTPSDFDKLKQYLTMDRKVLRFFAVWDDTESMFGEKHPVLIHYYLSDDTVEIREVHERNDGRDPFPVLMKRQHLPKVVNDTKDTFPMCVLEISDQEVKEWFSPGDFKVGKHISILGRKFFIYDCDAYTRDFYRDKMGIGDLQPVEVNKEREDEEEKVIQEIPPYNGFGLLEDSLQNCLSLVPKPPKKDVLKMLENDHNVLRYVVILDSPNPEDKVRRFVLSYFLANDMLSIFERQVRNSGIIGGKFLEKSRVLVPGSTVDNPIYYGPKDFTIGAAIEVFNHRFIITDADEYVLNYMKAHSKEFPPHVLHSLERHLYPQPEI
Donor tissue: gastrula