ORFeome > fscn1 – XORFeome 2.0

fscn1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis fascin homolog 1, actin-bundling protein, mRNA (cDNA clone MGC:75811 IMAGE:5382303), complete cds
Gene Symbol: fscn1
Gene ID: 394733
ORF gb_acc: MG132907
ORF ID: 10272

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061323

Library Location

Plate ID: GDExt11004
Well Location: D04

EST Sequences

Clone: MGC:75811 IMAGE:5382303
Trimmed Sequence: ATGACTTCTGGACCCCTTCAACTCGGGCTCGTTAACTGCAACAACAAATACCTCACTGCCGAGGCTTTTGGATTCAAGATCAATGCTTCGGCAAGCAGTTTAAAGAAAAAGCAAGTGTGGAGCCTGGAGCCAGCGGGTGAAGATACTAGTGCCGTTTTACTTCGGAGCCACCTAGGCCGGTTCCTTTCTGCAGACAAAGATGGCAAAGTGTCGGGGGAGAGTGAGACTGCTGGACCCGAGTGCCGGTTCCTGGTCAGTGCGCAGGGGGACGGGCGTTGGGCGCTGCAGTCCGAGGCGTACGGCCGGTACTTCGGAGGTTCAGAGGATCGAATTAGTTGTTTCTCTCCTTCGGTTTCCCCTGCCGAGAAGTGGGGAGTTCACTTGGCCATGCACCCACAGTTCACACTATATAGCGTGACCCGCAAACGATATGCCCGCCTGAGTGCCAATGGCGACGAGTTATCCGTGGAACGGGACGTGCCTTGGGGTGTAGACTCGCTCATTACTCTCATTTTCCAGGACAATCGCTATAGCATACAAACCCCTGATCATCGCCTGTTGGCCTCCGATGGCAGCCTTAGAGACGGGCCCGGTCCGGACACCGGTTATACGCTGGACATTTCATCTGGGAAAGTGGCATTTAGAGCCAATGATGGTCGTTACTTGACCTCTTCCGGCCCAAGTGGAACCATGAAGGCAGGCAAGAACAGCAAGGCCGGGAGAGACGAGCTGTTTGTCCTGGAAAGAAGCTGCCCGCAAGTGGTTCTTACTGCGGGGAACGGGAGGAACGTGTCTACAAGGCAGGGTATTGATCTTTCAGCAAATCAGGATGAGGAGAGTGACCAGGAAACATTTCAACTGGAAATCAACAAAGAGACAAAGATGTGTGCTTTCCGGACTCACACTGGAAAGTACTGGACCCTTTCCAACAATGGAGGGATTCAGGCATCTGCTTCTACACTGAATAACAGCTGTTATTTTGATATTGACTGGTGCGACCGTAGAATCACCCTTAAGGGAGTCAATGGAAAATTTGTCACAGCAAAGAAGAATGGCCAACTGTCAGCTTCTATAGATACACCAGCAGAGACGGAGCTGTTTTTAATGAAGCTTATTAACCGTCCACTGATCGTTCTGAGGGGTGAGCATGGTTTCATTGGCTGCCGTAAAATGACTGGAACCCTTGATTCCAATCGCTCCATTTATGATGTATTTGAACTGGAATTCAATGATGGTGCTTACAGCCTCAAAGATTCCACTGGGAAATACTGGACTGTGGGAAGTGATATGTCTGTTACCAGCAGTAGTCCCACTCGGGTGGATTTCTACTTCGAATTCTGTGACTACAACAAAGTGGCAATCAAAGTCAATGGCCTTTATCTCAAAGGTGACCATGCTGGTGTTCTGAAAGCAAATGCGGAGACCATCGACTCTTCCACACTCTGGGAATACTAA
Full Trace Sequence: ctttgggctagcggaacgggcttgagcatcttactggcaacatgacttctggaccccttcaactcgggctcgttaactgcaacaacaaatacctcactgccgaggcttttggattcaagatcaatgcttcggcaagcagtttaaagaaaaagcaagtgtggagcctggagccagcgggtgaagatactagtgccgttttacttcggagccacctaggccggttcctttctgcagacaaagatggcaaagtgtcgggggagagtgagactgctggacccgagtgccggttcctggtcagtgcgcagggggacgggcgttgggcgctgcagtccgaggcgtacggccggtacttcggaggttcagaggatcgaattagttgtttctctccttcggtttcccctgccgagaagtggggagttcacttggccatgcacccacagttcacactatatagcgtgacccgcaaacgatatgcccgcctgagtgccaatggcgacgagttatccgtggaacgggacgtgccttggggtgtagactcgctcattactctcattttccaggacaatcgctatagcatacaaacccctgatcatcgcctgttggcctccgatggcagccttagagacgggcccggtccggacaccggttatacgctggacatttcatctgggaaagtggcatttagagccaatgatggtcgttacttgacctcttccggcccaagtggaaccatgaaggcaggcaagaacagcaaggccgggagagacgagctgtttgtcctggaaagaagctgcccgcaagtggttcttactgcggggaacgggaggaacgtgtctacaaggcagggtattgatctttcagcaaatcaggatgaggagagtgaccaggaaacatttcaactggaaatcaacaaagagacaaagatgtgtgctttccggactcacactggaaagtactggaccctttccaacaatggagggattcaggcatctgcttctacactgaataacagctgttattttgatattgactggtgcgaccgtagaatcacccttaagggagtcaatggaaaatttgtcacagcaaagaagaatggccaactgtcagcttctatagatacaccagcagagacggagctgtttttaatgaagcttattaaccgtccactgatcgttctgaggggtgagcatggtttcattggctgccgtaaaatgactggaacccttgattccaatcgctccatttatgatgtatttgaactggaattcaatgatggtgcttacagcctcaaagattccactgggaaatactggactgtgggaagtgatatgtctgttaccagcagtagtcccactcgggtggatttctacttcgaattctgtgactacaacaaagtggcaatcaaagtcaatggcctttatctcaaaggtgaccatgctggtgttctgaaagcaaatgcggagaccatcgactcttccacactctgggaatactaagcataatctggggctaaattattagccgtgtcaaatgtgtcccttgtgcctgtttgctcttaacagggcaatataatacaaatcttgtcttgcttggagtaacagttctttctttattttagtcagtatctgcagtttttgaccaaatatacacctatagccttctataggtgcctataatatacacctatagcacttctttggtgcagggcgttgtttattgccacaatcttagtaccctctactgttctatagtaagtttttaaaatggatccttaaagaaatgcagatgtggataatttgacccatgtcatattttaatatttgtttacatccattaacagaactgcttcttaacaaggtatttttaactctggtaggattcctgggattgacccccttgctagctttaagaactatattagtctttaacagtcttgatgaggagaaaagaaaatgtcatgtcttaggaggccctttaagtggcagtggtcataatttgccaagtgctagctattttgaaaaaatgtttgcttttttaaaataatgcgaaacttgcacatttaacaatttatgcctagtatttcatagggccatattcctccctgtagaaaggtttatgtaattggaaaggtagaatattaatagtaataaacagtattaaatatcttttatttacttttatgtttactgataagcctcatctcaatgtttgacatattatttcggcagtgaatttaatatactttgtggtgctaaatgacaatgctctaaattttaaaataactcaaatgtcataaaatgtatcaccaacagttgatatcaaagattgaatacgtggtattgtttgtatattaatctgggctatttaatctgtctgctgtaccactgatctgaacaccagttcagtgagcagatgtgactaaaggctcggtggtttcgcactcctgtgaattgatctgtaaagctgccacatgctgattataatgtcttaagtgccattttcagaacatcgcagtgtagagaaataaatacattttgtcccagtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTSGPLQLGLVNCNNKYLTAEAFGFKINASASSLKKKQVWSLEPAGEDTSAVLLRSHLGRFLSADKDGKVSGESETAGPECRFLVSAQGDGRWALQSEAYGRYFGGSEDRISCFSPSVSPAEKWGVHLAMHPQFTLYSVTRKRYARLSANGDELSVERDVPWGVDSLITLIFQDNRYSIQTPDHRLLASDGSLRDGPGPDTGYTLDISSGKVAFRANDGRYLTSSGPSGTMKAGKNSKAGRDELFVLERSCPQVVLTAGNGRNVSTRQGIDLSANQDEESDQETFQLEINKETKMCAFRTHTGKYWTLSNNGGIQASASTLNNSCYFDIDWCDRRITLKGVNGKFVTAKKNGQLSASIDTPAETELFLMKLINRPLIVLRGEHGFIGCRKMTGTLDSNRSIYDVFELEFNDGAYSLKDSTGKYWTVGSDMSVTSSSPTRVDFYFEFCDYNKVAIKVNGLYLKGDHAGVLKANAETIDSSTLWEY
Donor tissue: neurula