ORFeome > g3bp2 – XORFeome 2.0

g3bp2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis GTPase activating protein (SH3 domain) binding protein 2, mRNA (cDNA clone MGC:75649 IMAGE:5379625), complete cds
Gene Symbol: g3bp2
Gene ID: 394887
ORF gb_acc: MG132866
ORF ID: 10223

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064172

Library Location

Plate ID: GDExt11003
Well Location: D04

EST Sequences

Clone: MGC:75649 IMAGE:5379625
Trimmed Sequence: ATGGTGATGGAGAAGCCAAGTCCCCTGCTTGTAGGGCGGGAGTTTGTGAGACAGTACTACACACTTTTAAATAAAGCACCAGACTTTTTGCACAGGTTTTATGGAAGAAATTCTTCTTACGTACATGGAGGGCTGGATGCCACTGGAAAGCCACAAGAAGCCGTTTATGGCCAGGCTGAAATTCACAAAAAGGTGATGTCTCTTCAGTTCAGTGAATGTCGTACCAAAATCCGGCACGTAGATGCACATGCTACACTGAGCGATGGCGTTGTGGTGCAAGTTATGGGTGAACTTTCCAATAATGGACAGCCAATGAGAAAGTTCATGCAGACGTTTGTCCTTGCTCCAGAAGGTTCGGTTCCAAACAAATTCTATGTCCATAATGACATCTTTCGCTATGAAGATGAAGTTTTTGGTGACTCAGAAGCAGAGATGGATGAAGAATCTGAAGAGGAAGTAGAGGAGGAGCAAGAGGAAAGGCAACCTTCTCCTGAACCAGCGCAAGAGAACACCAACAATGCATACTATGAGCCTCACCCTGTTTCCAATGGAGTGGAGGAGCCTTTAGAGGAGCCAGTTAATGAACCAGAACCAGAACCTGAACCAGAAATAAAGAATGAGGAGATAAAGCCAGAGACAGAAGAAAAAGTGCAAGAGGAGTTGGAAGAAAAATCACCAACCCCACCGCCTGCTGAGCCTGTTGTTCTGCCACAAGAACCACCCAAGGCTTTCTCCTGGGCATCAGTGACCAGTAAAAACCTGCCTCCCAGTGGTACTGTGCCAGCATCAGGAATACCACCCCATGTAATTAAAGCTCCAGCCTCACAGGCAAGAGTGGATGTTAAACCAGAAGCTCCAGCTCAGTCTCTCCGTGTAAGAGAACAGCGTCCTCGGGAAAGACCAGCTTTTCAGCCAAGAGGTCCAAGGGTAGGAGGTCGAAGTGACAATGAACAGTCGGAGTCTGATAATCGTCGTATGTACCGCTACCCTGACAGTCACCAACTGTTTGTTGGAAACTTGCCACATGATATTGATGAAAGTGAACTGAAAGAATTCTTTATGAGTTATGGAAATGTGATGGAGCTTCGTATTAATACCAAAGGCGTTGGTGGGAAACTACCAAACTTTGGCTTTGTTGTGTTTGATGACTCTGAGCCAGTTCAGCGAATTTTGCTTTCAAAACCAATTATGTTTCGTGGAGAGGTACGGTTAAATGTGGAAGAGAAGAAAACAAGGGCTGCAAGAGAAAGGGAAACCCGTGGTGGAGACGACCGCAGAGATATACGACGCAATGATAGGGGACCTGGAGGGCCTCGTGGGCTCATCAGTGGTGGAATGGTTCGTGACAGGGATGGAAGGGGCCCTCCACCACGAGGAGGAATGGTCCAAAAGCTTGGCAGCGGACGTGGAGGAGCACCACCTGTAGAGGGTCGTTTCTCTGGCCAGCGCCGCTGA
Full Trace Sequence: gtcagcaggagaacgccataatcccgcccagcaagctgccgcctgcagcctaacggggtgagaaaattcattacggtcttatatcatccgacgggtatcgggactccttattccgtgtccgggggaatagtggcctcctgaccggctctggcagagcacattactttctgtaccaaagaaatggtgatggagaagccaagtcccctgcttgtagggcgggagtttgtgagacagtactacacacttttaaataaagcaccagactttttgcacaggttttatggaagaaattcttcttacgtacatggagggctggatgccactggaaagccacaagaagccgtttatggccaggctgaaattcacaaaaaggtgatgtctcttcagttcagtgaatgtcgtaccaaaatccggcacgtagatgcacatgctacactgagcgatggcgttgtggtgcaagttatgggtgaactttccaataatggacagccaatgagaaagttcatgcagacgtttgtccttgctccagaaggttcggttccaaacaaattctatgtccataatgacatctttcgctatgaagatgaagtttttggtgactcagaagcagagatggatgaagaatctgaagaggaagtagaggaggagcaagaggaaaggcaaccttctcctgaaccagcgcaagagaacaccaacaatgcatactatgagcctcaccctgtttccaatggagtggaggagcctttagaggagccagttaatgaaccagaaccagaacctgaaccagaaataaagaatgaggagataaagccagagacagaagaaaaagtgcaagaggagttggaagaaaaatcaccaaccccaccgcctgctgagcctgttgttctgccacaagaaccacccaaggctttctcctgggcatcagtgaccagtaaaaacctgcctcccagtggtactgtgccagcatcaggaataccaccccatgtaattaaagctccagcctcacaggcaagagtggatgttaaaccagaagctccagctcagtctctccgtgtaagagaacagcgtcctcgggaaagaccagcttttcagccaagaggtccaagggtaggaggtcgaagtgacaatgaacagtcggagtctgataatcgtcgtatgtaccgctaccctgacagtcaccaactgtttgttggaaacttgccacatgatattgatgaaagtgaactgaaagaattctttatgagttatggaaatgtgatggagcttcgtattaataccaaaggcgttggtgggaaactaccaaactttggctttgttgtgtttgatgactctgagccagttcagcgaattttgctttcaaaaccaattatgtttcgtggagaggtacggttaaatgtggaagagaagaaaacaagggctgcaagagaaagggaaacccgtggtggagacgaccgcagagatatacgacgcaatgataggggacctggagggcctcgtgggctcatcagtggtggaatggttcgtgacagggatggaaggggccctccaccacgaggaggaatggtccaaaagcttggcagcggacgtggaggagcaccacctgtagagggtcgtttctctggccagcgccgctgaatcttgtcacaattaacatccagtaaagcctacagtggtaccttaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVMEKPSPLLVGREFVRQYYTLLNKAPDFLHRFYGRNSSYVHGGLDATGKPQEAVYGQAEIHKKVMSLQFSECRTKIRHVDAHATLSDGVVVQVMGELSNNGQPMRKFMQTFVLAPEGSVPNKFYVHNDIFRYEDEVFGDSEAEMDEESEEEVEEEQEERQPSPEPAQENTNNAYYEPHPVSNGVEEPLEEPVNEPEPEPEPEIKNEEIKPETEEKVQEELEEKSPTPPPAEPVVLPQEPPKAFSWASVTSKNLPPSGTVPASGIPPHVIKAPASQARVDVKPEAPAQSLRVREQRPRERPAFQPRGPRVGGRSDNEQSESDNRRMYRYPDSHQLFVGNLPHDIDESELKEFFMSYGNVMELRINTKGVGGKLPNFGFVVFDDSEPVQRILLSKPIMFRGEVRLNVEEKKTRAARERETRGGDDRRDIRRNDRGPGGPRGLISGGMVRDRDGRGPPPRGGMVQKLGSGRGGAPPVEGRFSGQRR
Donor tissue: tailbud