ORFeome > gata3 – XORFeome 2.0

gata3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis GATA binding protein 3, mRNA (cDNA clone MGC:89310 IMAGE:6986505), complete cds
Gene Symbol: gata3
Gene ID: 448391
ORF gb_acc: MG133803
ORF ID: 11375

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075479

Library Location

Plate ID: GDExt11014
Well Location: G01

EST Sequences

Clone: MGC:89310 IMAGE:6986505
Trimmed Sequence: ATGGAGGTCTCAGCCGAGCAGCCTCGCTGGGTCAGTCACCCTCACCACCCGGCTCTATTAAATGGACAGCACTCAGACTCTCATCACCCGGTCCATAACTACATAGACCCCACACAGTACCCCCCGCCAGAGGACATGGATGTACTCTTCAATATCGATGGACAAGGAAACCACGTCCCTTCTTACTACAGCAACTCTGTCCGAACGGTGCCCAGATACCCCCCGCCACACCATGGAAGCCTAGTGTGCCACCCCTCTATCCTACAAAGTTGGACAGATGGGCGCAAGTCTTTGGGAGGACCCCACGCCGCTTCAGCCTGGAATCTGCCCTTCGCCAAGCCTTCCATTCATCACAACTCCCCCGGAGGACTTTCTGTCTATCCCCCTGCCTCCTCGGCATCCCTGGCTACAGGACATTCCAGCCCCCACCTCTTCACCTTTCCCCCCACTCCACCAAAAGATGTCTCCCCGGACCCTTCTATTTCCACCTCTGTATCCACATCCTCCAGCAGGCATGAGGAGAAGGAATGTGTAGTGTCCAAGTATCAAGTGTCCCTGTCCGAACCTGGCATGAAACTGGAATCCTCACACCCCAGGAACAGCATGTCAGGAATTGGGGGAGTCTCCTCTGCCCACCACCCCATTACTACCTACCCTGACTATTACGGCGCAGGGCTTTTTCAGCCTGGTAGCATTTTGGATGGTTCTCCAACTCACTTTCCCAGTAAGCCAAGGCCCAAAACTCGCTCAAGTACAGAAGGCAGGGAGTGTGTAAACTGTGGGGCAACTTCAACCCCCCTCTGGAGGAGAGATGGCACTGGACATTATCTATGCAATGCATGTGGACTCTATCATAAAATGAACGGCCAGAATCGACCCCTCATTAAACCCAAAAGAAGGCTGTCTGCAGCAAGGAGGGCAGGTACATCCTGTGCAAACTGTCAAACCACCACCACGACACTGTGGAGGAGAAATGCCAATGGAGATCCTGTGTGTAATGCCTGTGGGCTGTATTACAAGCTGCACAATATTAACAGACCACTGACTATGAAGAAGGAAGGCATTCAGACCAGAAACCGAAAAATGTCTAGCAAGTCAAAAAAGAGCAAAAAGATCCACGACAGCCTGGAGGACTACCCTAAGAGCAGCTCATTCAGTCCTGCTGCCCTCTCGAGACACATGTCTTCCCTCAGCCACATTTCACCTTTTAGCCACTCCAGTCATATGCTAACCACACCGACACCAATGCACGCTCCGTCCGGTCTTTCCTTTGGACCCCATCACCCTTCCAGTATGGTCACTGCAATGGGTTAG
Full Trace Sequence: ctgcactgtaacaaaactagggagagagagggagagagcagcagatctgatcagccactttctgcttcttcttctgggatcacacacctccttcccctacaactttgtactttgtgtagcaggctgcttgccgggggaggaccccctgcgccccaggtggcacagcatagttggctcctgctcattccctggagaactttttgggactttacatcagtgcagaagcttagagcctggcacggcttaatatccttactatttctcttgcagactttgcagaaccccctccagcttgcgtcttacattgtttttttcccttgtaggtcatagatagctctggatttattttaatttttgtttctgcacttactggacttttcctgtgcgctgtgactagtgacttgggtgcgtctctccaggcaagtgcctactggtgctagtgggcatggaggtctcagccgagcagcctcgctgggtcagtcaccctcaccacccggctctattaaatggacagcactcagactctcatcacccggtccataactacatagaccccacacagtaccccccgccagaggacatggatgtactcttcaatatcgatggacaaggaaaccacgtcccttcttactacagcaactctgtccgaacggtgcccagataccccccgccacaccatggaagcctagtgtgccacccctctatcctacaaagttggacagatgggcgcaagtctttgggaggaccccacgccgcttcagcctggaatctgcccttcgccaagccttccattcatcacaactcccccggaggactttctgtctatccccctgcctcctcggcatccctggctacaggacattccagcccccacctcttcacctttccccccactccaccaaaagatgtctccccggacccttctatttccacctctgtatccacatcctccagcaggcatgaggagaaggaatgtgtagtgtccaagtatcaagtgtccctgtccgaacctggcatgaaactggaatcctcacaccccaggaacagcatgtcaggaattgggggagtctcctctgcccaccaccccattactacctaccctgactattacggcgcagggctttttcagcctggtagcattttggatggttctccaactcactttcccagtaagccaaggcccaaaactcgctcaagtacagaaggcagggagtgtgtaaactgtggggcaacttcaacccccctctggaggagagatggcactggacattatctatgcaatgcatgtggactctatcataaaatgaacggccagaatcgacccctcattaaacccaaaagaaggctgtctgcagcaaggagggcaggtacatcctgtgcaaactgtcaaaccaccaccacgacactgtggaggagaaatgccaatggagatcctgtgtgtaatgcctgtgggctgtattacaagctgcacaatattaacagaccactgactatgaagaaggaaggcattcagaccagaaaccgaaaaatgtctagcaagtcaaaaaagagcaaaaagatccacgacagcctggaggactaccctaagagcagctcattcagtcctgctgccctctcgagacacatgtcttccctcagccacatttcaccttttagccactccagtcatatgctaaccacaccgacaccaatgcacgctccgtccggtctttcctttggaccccatcacccttccagtatggtcactgcaatgggttagtctttgtacctttgtcttccaaaaaggacctcatctctatttgcattttttttgctggaggttgatgatctctttaggatggaaaaaaatttatttaattgctcacacaatgttgtgtttgccacttttataggaactcactatggcatctacgcattctcaaccactgaatctggattccatttgtgaataagccatttaaccttctattccctgttgataagggtttctagtgctgtgaacaacaacaacaaaaatattgatgaattgtacatctaactattctatcataagaaatactgtatatatggagacttttactgccacttggcacctatacaaaggagcatgaaggactaaaggagctttacggatgagtcgaggagaactataacttgtacattgccagacttcttaactaactaaacaaacaaactgccggcaatgtttctggtgggtggaagctgtttgatgcatttgtagggagttcatccattcagactgtggggcctctccttaggaagtgctatcaatcccaggcaatcagtgttaccatgcggatattgccaataaggattttcagatggtcattcttcaggcctatatgcattgtgaataagttcctgtaattgttgtttgtatgtataattcaaaagcaccaaataaaagatgtagatttatttcatcatattatacagactgaatggttgtataaatgtatttactactagtgtaaagaactgcttttattgttttcatattatatttctttcttcaaaaataaaatagactaaattctgttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEVSAEQPRWVSHPHHPALLNGQHSDSHHPVHNYIDPTQYPPPEDMDVLFNIDGQGNHVPSYYSNSVRTVPRYPPPHHGSLVCHPSILQSWTDGRKSLGGPHAASAWNLPFAKPSIHHNSPGGLSVYPPASSASLATGHSSPHLFTFPPTPPKDVSPDPSISTSVSTSSSRHEEKECVVSKYQVSLSEPGMKLESSHPRNSMSGIGGVSSAHHPITTYPDYYGAGLFQPGSILDGSPTHFPSKPRPKTRSSTEGRECVNCGATSTPLWRRDGTGHYLCNACGLYHKMNGQNRPLIKPKRRLSAARRAGTSCANCQTTTTTLWRRNANGDPVCNACGLYYKLHNINRPLTMKKEGIQTRNRKMSSKSKKSKKIHDSLEDYPKSSSFSPAALSRHMSSLSHISPFSHSSHMLTTPTPMHAPSGLSFGPHHPSSMVTAMG
Donor tissue: gastrula