ORFeome > gem – XORFeome 2.0

gem – XORFeome 2.0

General Information

Species: Xenopus tropicalis GTP binding protein overexpressed in skeletal muscle, mRNA (cDNA clone MGC:147442 IMAGE:7805796), complete cds
Gene Symbol: gem
Gene ID: 100038040
ORF gb_acc: MG136553
ORF ID: 15008

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC121659

Library Location

Plate ID: GDExt11047
Well Location: B09

EST Sequences

Clone: MGC:147442 IMAGE:7805796
Trimmed Sequence: ATGACTTTGAATGTGACCATGCGTCGCAGCAACACCACGGCCAATGTACAGCAGCGATGGAGCATCCCGGCTGATGCAAAGAACATTCACGCTCAGAAAAAGCAGCACTCTAACCTCACCCGCAAATACACCGCCAATAACACAAGCATCAATAACTCAGCAGAGTACTGCCGGAGAAGCTGGTCATCTGACTCTTCCGACTCCGTCATCTCTTCTGAGTCTGGGAGTACCTACTACCGGGTGGTGCTGATTGGGGAGCAAGGAGTTGGGAAGTCTACTCTGGCTAATATATTTGCAGGGGTGCCTGATTCTGTGGATGGTGACTGCGATATGTTAGCAGAAAACACTTATGAAAGAAACTTGATGGTGGACGGAGAAAGCGCAACTCTGATTCTAATCGATATGTGGGAAAATAAGGCTCAAGACAACTGGATCCGTGAGCAGTGCATGCAGGTTGGAGATGCCTACCTTATTGTCTACTCCATCACTGACAGAGCAAGCTTTGAGAAAGCCTCTGAGCTGCGCATACAACTCCGTCGGGCGCGGCAGACAGAGGACATCCCCATTATACTTGTGGGCAATAAAAGCGACCTTGTCCGTTGCCGAGAGGTCTCTGTCTCAGAGGGCAGAGCATGTGCTGTGGTGTTTGACTGCAAGTTCATTGAGACATCAGCAGCCGTCCAACACAACGTGAAGGAACTCTTTGAAGGGATTGTTCGTCAGGTGCGTTTAAGGCGAGACAGCAAGGAGAAAAACGAGAGACGATTGGCCTATCAGAAGAGGAGAGAAAGTATCCCCAAGAAAGCCAGGAGGTTCTGGGGCAAAATAGTAGCCAAGAAAAACAAAAACATGGCTTTTAAGCTAAAATCCAAATCTTGCCATGACCTCTCTGTACTATAA
Full Trace Sequence: ctctattctacactcaggactccaggctcagggggagagtataaggggacaagcaataaagccagagaacgatgactttgaatgtgaccatgcgtcgcagcaacaccacggccaatgtacagcagcgatggagcatcccggctgatgcaaagaacattcacgctcagaaaaagcagcactctaacctcacccgcaaatacaccgccaataacacaagcatcaataactcagcagagtactgccggagaagctggtcatctgactcttccgactccgtcatctcttctgagtctgggagtacctactaccgggtggtgctgattggggagcaaggagttgggaagtctactctggctaatatatttgcaggggtgcctgattctgtggatggtgactgcgatatgttagcagaaaacacttatgaaagaaacttgatggtggacggagaaagcgcaactctgattctaatcgatatgtgggaaaataaggctcaagacaactggatccgtgagcagtgcatgcaggttggagatgcctaccttattgtctactccatcactgacagagcaagctttgagaaagcctctgagctgcgcatacaactccgtcgggcgcggcagacagaggacatccccattatacttgtgggcaataaaagcgaccttgtccgttgccgagaggtctctgtctcagagggcagagcatgtgctgtggtgtttgactgcaagttcattgagacatcagcagccgtccaacacaacgtgaaggaactctttgaagggattgttcgtcaggtgcgtttaaggcgagacagcaaggagaaaaacgagagacgattggcctatcagaagaggagagaaagtatccccaagaaagccaggaggttctggggcaaaatagtagccaagaaaaacaaaaacatggcttttaagctaaaatccaaatcttgccatgacctctctgtactataaatgaagtcggacttcccaacaagagcaaaatatgttaaactgatgggaaatcatttagcaattttgccaaccaataatcaatctatattagattggacatgaccacaatttacttgtgctttcttcagccatggatgccacaacagtcaactttgtgttatcttcagccatgatactcagatctgccattgcgctgactttgtgatacgagagatgcaaaacttttgtttccatttggggattttgtaagttttgatcatccgggaacggagagatcagagacaggaactaaattgcactgaagaaacttgatgtatggctgtcatgctgtattctcatcagtgggagaaaccatcgaatcatctgctgcagttatttcctcatgtcatatttatattgccttattttatagcatctgataacaatttttacatgcaactccagtttgttgggggagaaactatgcaagcgacttttccatgcagctaacacagggaaggccaatcggaatatctccagctgatataaagacacacggagcttcttagtggcaactacttgtcatggctactaaacaccagataataccctgccatagacaatactgagaattatcagtaaaagatcaacatcgtctattttagtaggcgcagcaagtagctgcttctagtagctctgtgtgtcttcaccctaaaggtcaccaacagtcagagagcttccagctgcccgtgccttatctaacaatatcttattctaatattaattaataggagtaatactaacaatcaccatacacgcccagtttcccaaagttcttcttcttcttgctacacagaaaatatttttgtttaaaaaatatttttgatcgcctacttcgatattttttatacttgattttttttgtcaaaatcaaaatgctgttttttttttttaccttagaaagagaatagacttatttgaaactatggtaataatacaactgcctttttgtatgttctgtatctgttcatttttagaaaatgaaatgggcaaatgggggcaagatttggggaatgtaaaaactgctggaacttgtcacccaaagtagccagtcaccaggaagcatctattgggctcccagacctggatcaattttttgccaacacgcatgaataaaataatgatgtgccttctggtaaacctattataacagggtgtttccctttctactcatgtggccctggaggaaaaccaatggaaacagtttcctcttaaacggcgattgcagtcatatggtactgcttgctccatgcattaaacattaaggcatatggatacagtgggaaggtttaggctttctgtgcaagtaggtgatggatacaggtatatgctttgtaatgggacaggtcaataagaaggcaaaataagaaagatgatgatacttatagtaccgttgaagacatggagggttaggataggataagataggataagatgttgctgctgactggggactaaaagaaggatgctccagggcttctaggggtgccagtggcaacagctgcactttattgacctctgataattgattctatggcaaataccctctgccaccagttccagaatatgcacaaagattcataaacctgatgtattctttagcttgggatagagatagcaatgtggcaactatatatttattatttggtttcctgtaatatttctattcatttctattagttttttttacctggtacatcataaaatgaaaaataaagataaatcagaccgcaaaaaaaaaaaaaaaaaa
Translation: MTLNVTMRRSNTTANVQQRWSIPADAKNIHAQKKQHSNLTRKYTANNTSINNSAEYCRRSWSSDSSDSVISSESGSTYYRVVLIGEQGVGKSTLANIFAGVPDSVDGDCDMLAENTYERNLMVDGESATLILIDMWENKAQDNWIREQCMQVGDAYLIVYSITDRASFEKASELRIQLRRARQTEDIPIILVGNKSDLVRCREVSVSEGRACAVVFDCKFIETSAAVQHNVKELFEGIVRQVRLRRDSKEKNERRLAYQKRRESIPKKARRFWGKIVAKKNKNMAFKLKSKSCHDLSVL
Donor tissue: fat body