ORFeome > ggt1 – XORFeome 2.0

ggt1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis gamma-glutamyltransferase 1, mRNA (cDNA clone MGC:89258 IMAGE:6976483), complete cds
Gene Symbol: ggt1
Gene ID: 448376
ORF gb_acc: MG133830
ORF ID: 11407

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075461

Library Location

Plate ID: GDExt11013
Well Location: H09

EST Sequences

Clone: MGC:89258 IMAGE:6976483
Trimmed Sequence: ATGCGGAAACGCTTTATATTAACAGGAGTCCTTGCCGTCGTGCTGGTGGCACTTGCACTATTCTTTGGCCTCTATTTTGGATTGCATGGTGGTAATGCAGAATATGTCTATGCAAGAGCAGCTGTAGCCACTGATGCAGGAAAGTGTTCAGAGATTGGAAGGGATATCCTGAAGGAAGCGGGCTCAGCTGTAGATGCTGCTATTGCCTGCCTTCTCTGTGTTGGACTTCTAAATGCTCACAGCATGGGGATCGGAGGTGGTGCCATCTTGACTATTTATGATTCCAAAACTGGAAAAGCTGAAGTTATAAATGCTCGGGAAAGGGCTCCACTGGCCGCAACAGAGGAAATGTATGGAAACAACAGTCAATTAGCCCAGATTGGTGGCAAGTCAATAGCAGTGCCTGGGGAGATCCGAGGATACCAGTTGGCACACAAGCGTCATGGCAAGCTTCCATGGAAACGGTTATTTGAACCAAGCATTAAATTGGCACGAGAGGGGTTTCCTGTAGGCTTGGGACTCGAACAAGGGCTGAATAGAAGCAGGGAGGCGATTGAGAGTAATCCATTACTCTGTGAGGTGTTCTGTGGTCCAGATGGCCATGTGCTGCAGATGGGAGATATAGTAAAGATGCCAAAACTAGCAAACACTCTACAGACCTTGGCAGATGAAGGTCCTGATGCTTTCTACACAGGTTCCCTGTCTAAGCAGATAGTGAAGGACATCCAGGATGCAGAAGGTATTATCACAGAAGAAGATCTACGTAATTATACAGTGGACTTCCAGGATGACCCACTCCAGTTCTCACTGGGAGACTTCACTTTGGTCAGTCCCACTGCACCCCTAAGTGGGCCTGTCCTTGGACTTATCATGAACATCTTAAAAGGTTATAATTTTTCAAGACAAAGTGTGGAGACAGACGAGAAACTTGGGTTAACCTATCACCGTATTTTAGAGGCCTTCCGTTTTGCTTATGCCAAGAGAACATTATTAGGAGATCCCATGTATGAGAACATGACTGAGGTGATAAAGAACTTGACCTCAGTTTATTATGCTGAAGCGCTGAGACAGAAAATCACAGATGATACTACTCACCAGCCTGACTATTATGAACCAACTTACTTCATACAAGACTCGCATGGCACAGCCCACCTATCAATTGTAGCTGAAGATGGCAGTGCTGTATCTGCAACTAGTACCATTAACCGCTATTTTGGTTCTAAGGTTATTTCCAATGTGACAGGAATCATTTATAATGACGAAATGGATGATTTCAGCTCCCCTCTGATAAATAGCGGCTTTGACATCCCACCTTCACCAGCAAATTTTATTAAACCAGGAAAGCGACCCCTTTCTTCCATGTGCCCCTCAATCATTCTGGACAAGAACAAAAAGGTGCACCTAGTGGTTGGAGCTTCTGGAGGCCCAAAAATAACAACTTCAGTAGCACTGGCCATTATGAGCACACTCTGGTTTGGTTATGATGTTAAGAAGGCAGTGGAGGCACCTCGATTACACAACCAACTTTTCCCTGGTAACTCAACACTGGAGAAAACAATAAATCAGATAGCAGTAGAGGAGCTCATAAAGCGCAACCACAATGTAAGTTTTGAGACCTATGCCTTTGGATCTGTAGTCCAGGCAGTTTTGCACAGTGATGGCAAATGGGCTGCAGCCTCAGACTCACGAAAAGGGGGTTACCCAGCCGGCTATTAA
Full Trace Sequence: gcaggaagctgtcttatacagtgctgagcgtaggctcccagtttctggaagatgacagaaaattttaaggagacattcatgtaaaagaagtggattgcacaactttgggctgtaaggagtgacggcaagttgtgacgttctgaattgtgatgttgatataagagctgagccctgcagcaactcacctgggagcgaccatcgcaaatatgcattctttatttgaatacgaaaatctggatggtggagagtgggagatccagaatttggcaccaacaacactacttcatgacagagccatgcggaaacgctttatattaacaggagtccttgccgtcgtgctggtggcacttgcactattctttggcctctattttggattgcatggtggtaatgcagaatatgtctatgcaagagcagctgtagccactgatgcaggaaagtgttcagagattggaagggatatcctgaaggaagcgggctcagctgtagatgctgctattgcctgccttctctgtgttggacttctaaatgctcacagcatggggatcggaggtggtgccatcttgactatttatgattccaaaactggaaaagctgaagttataaatgctcgggaaagggctccactggccgcaacagaggaaatgtatggaaacaacagtcaattagcccagattggtggcaagtcaatagcagtgcctggggagatccgaggataccagttggcacacaagcgtcatggcaagcttccatggaaacggttatttgaaccaagcattaaattggcacgagaggggtttcctgtaggcttgggactcgaacaagggctgaatagaagcagggaggcgattgagagtaatccattactctgtgaggtgttctgtggtccagatggccatgtgctgcagatgggagatatagtaaagatgccaaaactagcaaacactctacagaccttggcagatgaaggtcctgatgctttctacacaggttccctgtctaagcagatagtgaaggacatccaggatgcagaaggtattatcacagaagaagatctacgtaattatacagtggacttccaggatgacccactccagttctcactgggagacttcactttggtcagtcccactgcacccctaagtgggcctgtccttggacttatcatgaacatcttaaaaggttataatttttcaagacaaagtgtggagacagacgagaaacttgggttaacctatcaccgtattttagaggccttccgttttgcttatgccaagagaacattattaggagatcccatgtatgagaacatgactgaggtgataaagaacttgacctcagtttattatgctgaagcgctgagacagaaaatcacagatgatactactcaccagcctgactattatgaaccaacttacttcatacaagactcgcatggcacagcccacctatcaattgtagctgaagatggcagtgctgtatctgcaactagtaccattaaccgctattttggttctaaggttatttccaatgtgacaggaatcatttataatgacgaaatggatgatttcagctcccctctgataaatagcggctttgacatcccaccttcaccagcaaattttattaaaccaggaaagcgacccctttcttccatgtgcccctcaatcattctggacaagaacaaaaaggtgcacctagtggttggagcttctggaggcccaaaaataacaacttcagtagcactggccattatgagcacactctggtttggttatgatgttaagaaggcagtggaggcacctcgattacacaaccaacttttccctggtaactcaacactggagaaaacaataaatcagatagcagtagaggagctcataaagcgcaaccacaatgtaagttttgagacctatgcctttggatctgtagtccaggcagttttgcacagtgatggcaaatgggctgcagcctcagactcacgaaaagggggttacccagccggctattaaacagaaatcatcttgtggactactgatttgatctagctggtatccatagactatgacaaactatttcaggaactcagggaccagattcagctgagtgtttatgaatcttggcaatctaccaaagatgatgtgctgctctcctatctcctcttgcttcagtcgccattttctccagcttagtaataaagagacatctgaagtgcacactgaggagactcctgtatgtgaacaaataattatagagtgtcatttccttccgctggtcgaagccctgctaaaactgttgcaccccaagactgatatacctggaaaagatgtagtattaaattatacaccaaaatggattccatctcttgatccccactctgtgccttctgcagactatagagaacggtccattgcagtttttggtttgggcactacatcccttatagcagggcaccccaacctttcttacttatgagccacagtcaaatgtaaaaaggcttgtgagcaacacaaacatcataaaagttcatgtgagtgccaaataagggctgtaattggctatttggtaaccccctatgcacacttttggcttataggagactttgtttggtagtagatcttgtttttattcaaccaaaacttgccaccaagtcaggaattgaaaaataactacctggtttgggggcactgagagcaacatccaaggggttggtgagcaacatgttgctcatgagcctctggttggggatcactgccttatagggagtgggaacaaagcagaaatagagactgcactcaaactaaatttcagatggggagcttaccccatttactatgccaatgtaccactcccttcgtcagaatttttttgtttgctgcatatagggagtggggccatttttgttttgtcaatttattgaggccattatcctgttcaatgggtgatcagtgtggaagatgttgaaacatctccgtcctaggaacaaataaattatatctctaataaatgtttcttttatctttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRKRFILTGVLAVVLVALALFFGLYFGLHGGNAEYVYARAAVATDAGKCSEIGRDILKEAGSAVDAAIACLLCVGLLNAHSMGIGGGAILTIYDSKTGKAEVINARERAPLAATEEMYGNNSQLAQIGGKSIAVPGEIRGYQLAHKRHGKLPWKRLFEPSIKLAREGFPVGLGLEQGLNRSREAIESNPLLCEVFCGPDGHVLQMGDIVKMPKLANTLQTLADEGPDAFYTGSLSKQIVKDIQDAEGIITEEDLRNYTVDFQDDPLQFSLGDFTLVSPTAPLSGPVLGLIMNILKGYNFSRQSVETDEKLGLTYHRILEAFRFAYAKRTLLGDPMYENMTEVIKNLTSVYYAEALRQKITDDTTHQPDYYEPTYFIQDSHGTAHLSIVAEDGSAVSATSTINRYFGSKVISNVTGIIYNDEMDDFSSPLINSGFDIPPSPANFIKPGKRPLSSMCPSIILDKNKKVHLVVGASGGPKITTSVALAIMSTLWFGYDVKKAVEAPRLHNQLFPGNSTLEKTINQIAVEELIKRNHNVSFETYAFGSVVQAVLHSDGKWAAASDSRKGGYPAGY
Donor tissue: tailbud