ORFeome > grwd1 – XORFeome 2.0

grwd1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis glutamate-rich WD repeat containing 1, mRNA (cDNA clone MGC:76117 IMAGE:5308892), complete cds
Gene Symbol: grwd1
Gene ID: 394881
ORF gb_acc: MG132738
ORF ID: 10038

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064215

Library Location

Plate ID: GDExt11001
Well Location: B06

EST Sequences

Clone: MGC:76117 IMAGE:5308892
Trimmed Sequence: ATGTCAGGCACTGGGGAAACCACATGGAGAAATCCCGCAGAGGATGAGGAGGAAGATGAAGGTATGGAAGAGTCGGGCAGCGAGGATGAAGATGACGAGGGTGATATTATGGAAGAAGAGGAGGACGATGAGAAGGACAAAGGGCCCAAGCGGGTCTATTTGCCCGGGATGGAGCCTCTTAAGGAGGGAGAAGAGCTGGTGATGGACCAGGAGGCGTATGTACTGTATCACCAGGCACAGACAGGTGCACCATGTTTAAGTTTTGATGTCATCCGTGATACCCTGGGGGAAAATCGCACAGATTACCCGCTGACTATGTACCTCTGCGCTGGTACTCAGGCCGACTCTGCTCAAGGCAACAGGATGCTGGTAATGAAAATGTACAATTTGCACCGTACAAGCAAGGAAAAGAAAGATGATTCCGATTCTGAAAGCAGTGACAGTGGCGAAGAAGAGGACGAGGAAGAAAAGAAGCCTCAGTTAGAGCTCGCTATGGTGCCTCATTATGGTGGCATTAATAGAATTCGCGTATCTACAATGGGGGAAGTACCCGTGGCTGCTGTCTGGTCAGAGAAAGGGCAAGTGGATATTTATGATCTAAGGAAGCAACTGTCGGCTGTGTCAGACTCTCAGGTGCTCGCTGCTTTTCTGAAGGAGGAACAAGCCAAAATCAAACCAGTGTTTTCTTTCTCCGGGCACATGACCGAAGGGTTTGCAATGGATTGGTCTCCAAAAACAGCAGGGCGCTTGGTTACTGGTGACTGCAATAAGAACATCCATCTGTGGGATCCAAGAGAAGGGGGAACGTGGCATGTTGACCAGAGACCATTCACGGGCCATACTAAATCTGTTGAGGATCTTCAGTGGTCTCCTACAGAAGCCACGGTGTTTGCCTCGTGCTCCGTTGATGCTTCCATTCGTATTTGGGACGTCCGAGCAGCCCCTAATAAAGCCTGCATGCTGACTGCCAGCCAAGCCCATGAGAGTGATGTCAATGTGATCAGCTGGAACCACCAAGAACCTTTCATTGTTAGCGGAGGAGATGATGGTGTCTTAAAGATCTGGGACCTTCGCCAGTTCCAGAAAGGAGTGAGCGTTGCCAAGTTCAAACAGCACACAGCTCCAATCACGTCAGTAGAGTGGCACCCAACCGACAGCGGCGTCTTTGCAGCGTCGGGAGCCGACGACCAGATAACACAGTGGGATCTTGCAGTTGAAAGAGATCAGGATCAGGAGGCAGAAACAGAAGACCCAGCATTGGCAGGCATCCCTCCCCAGCTGCTGTTTGTCCATCAAGGAGAAAAAGACATTAAAGAACTTCATTGGCATCCCCAGTGCCCGGGAGTAGTCGTCAGCACAGCCCTGTCCGGCTTTAATGTTTTCCGTACGATCAGTGTGTGA
Full Trace Sequence: cccgattccaagatgtcaggcactggggaaaccacatggagaaatcccgcagaggatgaggaggaagatgaaggtatggaagagtcgggcagcgaggatgaagatgacgagggtgatattatggaagaagaggaggacgatgagaaggacaaagggcccaagcgggtctatttgcccgggatggagcctcttaaggagggagaagagctggtgatggaccaggaggcgtatgtactgtatcaccaggcacagacaggtgcaccatgtttaagttttgatgtcatccgtgataccctgggggaaaatcgcacagattacccgctgactatgtacctctgcgctggtactcaggccgactctgctcaaggcaacaggatgctggtaatgaaaatgtacaatttgcaccgtacaagcaaggaaaagaaagatgattccgattctgaaagcagtgacagtggcgaagaagaggacgaggaagaaaagaagcctcagttagagctcgctatggtgcctcattatggtggcattaatagaattcgcgtatctacaatgggggaagtacccgtggctgctgtctggtcagagaaagggcaagtggatatttatgatctaaggaagcaactgtcggctgtgtcagactctcaggtgctcgctgcttttctgaaggaggaacaagccaaaatcaaaccagtgttttctttctccgggcacatgaccgaagggtttgcaatggattggtctccaaaaacagcagggcgcttggttactggtgactgcaataagaacatccatctgtgggatccaagagaagggggaacgtggcatgttgaccagagaccattcacgggccatactaaatctgttgaggatcttcagtggtctcctacagaagccacggtgtttgcctcgtgctccgttgatgcttccattcgtatttgggacgtccgagcagcccctaataaagcctgcatgctgactgccagccaagcccatgagagtgatgtcaatgtgatcagctggaaccaccaagaacctttcattgttagcggaggagatgatggtgtcttaaagatctgggaccttcgccagttccagaaaggagtgagcgttgccaagttcaaacagcacacagctccaatcacgtcagtagagtggcacccaaccgacagcggcgtctttgcagcgtcgggagccgacgaccagataacacagtgggatcttgcagttgaaagagatcaggatcaggaggcagaaacagaagacccagcattggcaggcatccctccccagctgctgtttgtccatcaaggagaaaaagacattaaagaacttcattggcatccccagtgcccgggagtagtcgtcagcacagccctgtccggctttaatgttttccgtacgatcagtgtgtgatgtttttactgtcccacttgctgcacagaaacctgcagttgattcatgttttctaacaagtactgaaaggttaaccatggtcaagaaaccaccataacttaaaagactggagactgatagtggcctgaatggtattgcagcagtaataaatagcatcactgtggcttacaaaaatcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSGTGETTWRNPAEDEEEDEGMEESGSEDEDDEGDIMEEEEDDEKDKGPKRVYLPGMEPLKEGEELVMDQEAYVLYHQAQTGAPCLSFDVIRDTLGENRTDYPLTMYLCAGTQADSAQGNRMLVMKMYNLHRTSKEKKDDSDSESSDSGEEEDEEEKKPQLELAMVPHYGGINRIRVSTMGEVPVAAVWSEKGQVDIYDLRKQLSAVSDSQVLAAFLKEEQAKIKPVFSFSGHMTEGFAMDWSPKTAGRLVTGDCNKNIHLWDPREGGTWHVDQRPFTGHTKSVEDLQWSPTEATVFASCSVDASIRIWDVRAAPNKACMLTASQAHESDVNVISWNHQEPFIVSGGDDGVLKIWDLRQFQKGVSVAKFKQHTAPITSVEWHPTDSGVFAASGADDQITQWDLAVERDQDQEAETEDPALAGIPPQLLFVHQGEKDIKELHWHPQCPGVVVSTALSGFNVFRTISV
Donor tissue: gastrula