ORFeome > gss – XORFeome 2.0

gss – XORFeome 2.0

General Information

Species: Xenopus tropicalis gss protein, mRNA (cDNA clone MGC:79600 IMAGE:6979255), complete cds
Gene Symbol: gss
Gene ID: 493407
ORF gb_acc: MG133629
ORF ID: 11172

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080930

Library Location

Plate ID: GDExt11012
Well Location: A03

EST Sequences

Clone: MGC:79600 IMAGE:6979255
Trimmed Sequence: ATGGAGGCTCTCTGGGAGGATATCTACAGCGACACAACACTGCTGGAGGAGTTGGCACCCATTGCAATTGACTCCGCTTTGCTGCAGGGGGTTTTGATGAGGACGAAAGCGAGTCCAAACTCATCGGATGTTGTGAATTTTGCCCCATTGACCCTTCTCCCATCCCCTGTGCCCAAAGCTCTATTTGAGCAAGCCAAGAGTGTGCAGGAAGATTTTAATCTGTTGGTGGATCGGATCAGCCAGGACACGGACTTCTTGGAAAAGGCTCTTTCCAGCACCGCCAAAGTGGATGATTTTATCCAACGGCTATTAAAAATCCAAAGGCAAGTTAAGAAAGAAGGTTGCGAACAGGAGGTGTTTTTGGGCATTAATCGATCGGACTACATGTTTGATTGTAGAGATGACGGGACGCCTGCTCTAAAACAGATCGAGATCAACACCATTGCTGCCAGTTTCGGGGGACTTTCCGCCCGGGTCCCTGAAGTTCATCAACACGTGCTAAAGGTTTTGAAGAAATCCGAAGAAGCGAGCAACATCTTACCCAACAATCCAGTTGAGGGGATCGCTTGGGGCATTGCAAGTTCCTGGGCAGTGTACGGCTCAACCAGTGCTGTTGTTCTGTTCCTGGTTGAGAACGTGCAAAGGAACATATTGGATCAACGCTGTATAGAAAATGAACTGATGAAAAGAAACGTCCGCACAATCAGAAGACGCTTAGCCGATGTGTATGAGAGAGGATCTCTAGACAAAGATAGAGGCCTGTTCCTGGATGGATACGAAATTGCAGTCGCCTATTTTCGAACTGGATATGTGCCTCAAGATTATACAGAGCAGGATTGGGAGGCACGGCTCATGTTGGAAAGATCCAGAGCTACAAAATGCCCAGATATAGCAACACAACTTGTTGGCACAAAGAAGATCCAGCAAGAACTGTGCCGCCCACACATTCTCGAGAAATTTCTTCCAGACAACCCTGAGGCAGTTGCTCGAATCAGAGAAACCTTCGCAGGCTTGTACTCCTTGGATACGGGTGAAGAAGGAGATGAAGCCGTGAAAGCGGCTCTTGCAAATCCAGACCAATTTGTGCTGAAACCACAGCGGGAAGGAGGAGGCAATAACCTGTATGGGGAAGAGCTGAAAGCAAAACTGGAGGAGTGCAAAGATAGTGAGGAACGGAACTCCTACATATTAATGGACAAGATCAATCCCAAGACAACAAAGAACTGCCTGCTGAGAGCGGGGGGCCCTGTGCAGATATCGGAGTGCATCAGTGAGCTGGGCATGTTCGGCGTCTATGTCAGGCGCAGTGGTGAAATGATCTACAACGAGCAAGTGGGTCATCTCCTACGGACAAAGGCCATAGAACACGCTGACGGTGGAGTAGCTGCAGGCGTGGCTGTCTTAGACAACCCTTACCTGGTATAA
Full Trace Sequence: gcccaggcactgagtgcggtcgctccctctgaaactctcctattattgcattttttaaagggtcaagatggaggctctctgggaggatatctacagcgacacaacactgctggaggagttggcacccattgcaattgactccgctttgctgcagggggttttgatgaggacgaaagcgagtccaaactcatcggatgttgtgaattttgccccattgacccttctcccatcccctgtgcccaaagctctatttgagcaagccaagagtgtgcaggaagattttaatctgttggtggatcggatcagccaggacacggacttcttggaaaaggctctttccagcaccgccaaagtggatgattttatccaacggctattaaaaatccaaaggcaagttaagaaagaaggttgcgaacaggaggtgtttttgggcattaatcgatcggactacatgtttgattgtagagatgacgggacgcctgctctaaaacagatcgagatcaacaccattgctgccagtttcgggggactttccgcccgggtccctgaagttcatcaacacgtgctaaaggttttgaagaaatccgaagaagcgagcaacatcttacccaacaatccagttgaggggatcgcttggggcattgcaagttcctgggcagtgtacggctcaaccagtgctgttgttctgttcctggttgagaacgtgcaaaggaacatattggatcaacgctgtatagaaaatgaactgatgaaaagaaacgtccgcacaatcagaagacgcttagccgatgtgtatgagagaggatctctagacaaagatagaggcctgttcctggatggatacgaaattgcagtcgcctattttcgaactggatatgtgcctcaagattatacagagcaggattgggaggcacggctcatgttggaaagatccagagctacaaaatgcccagatatagcaacacaacttgttggcacaaagaagatccagcaagaactgtgccgcccacacattctcgagaaatttcttccagacaaccctgaggcagttgctcgaatcagagaaaccttcgcaggcttgtactccttggatacgggtgaagaaggagatgaagccgtgaaagcggctcttgcaaatccagaccaatttgtgctgaaaccacagcgggaaggaggaggcaataacctgtatggggaagagctgaaagcaaaactggaggagtgcaaagatagtgaggaacggaactcctacatattaatggacaagatcaatcccaagacaacaaagaactgcctgctgagagcggggggccctgtgcagatatcggagtgcatcagtgagctgggcatgttcggcgtctatgtcaggcgcagtggtgaaatgatctacaacgagcaagtgggtcatctcctacggacaaaggccatagaacacgctgacggtggagtagctgcaggcgtggctgtcttagacaacccttacctggtataatgtggcctgtgatgcaggaaaggggggtgccatcagaaatcttgggtccaatgctgtggcttccctaggaaagggatccccccacctctcttggacctactgcagcacttttgccttcaccatagatggcgggccaggtggtccaactcaactacttaacgtgcctattattccttctgctaagcataatcggttctgatattcactgcactatttaacctcaatgtcttagcaagaaaagaagtcctatgttacttcagtgttccagtgggctgaatatatatcccagtgccttatccgattgccagggtgtgcggaatcatttcgatcagttaatgtgcccatgctgccagcaggtgagagaggtttgtgtgtgcagctagagtgtcgttgtttgtgataggctattgagtggaacataattcatctctaaatggctaccagtaagaccatcctggccaatactttccgtttcatatgtttttagccccccatcattgctttatccgcagggcgaggatctgctgtgtgtgacaataaccttagggtgttaaagaatcttgggctggatccttctctctctctgataacacagggttagttgatgtctatgcagtggagattgggtctactggggggaaagccgggtcagctctagtcttaatcaaaataattaatattttgtgctccattctgcaacactaaagtaacctgggttacacgttagcatggaaacaaccatatcttttgcttcaatggacattagaaccctgcacgtataatctattaaccatcttgttctgtttgtatgtcaagtgtttgtttcatgtatacattgttctattgtacagtgctgtggaatatgttgatcctttataaataattaaaaacaaatatgaaaataaaaaaaaaaaaaaaaaaa
Translation: MEALWEDIYSDTTLLEELAPIAIDSALLQGVLMRTKASPNSSDVVNFAPLTLLPSPVPKALFEQAKSVQEDFNLLVDRISQDTDFLEKALSSTAKVDDFIQRLLKIQRQVKKEGCEQEVFLGINRSDYMFDCRDDGTPALKQIEINTIAASFGGLSARVPEVHQHVLKVLKKSEEASNILPNNPVEGIAWGIASSWAVYGSTSAVVLFLVENVQRNILDQRCIENELMKRNVRTIRRRLADVYERGSLDKDRGLFLDGYEIAVAYFRTGYVPQDYTEQDWEARLMLERSRATKCPDIATQLVGTKKIQQELCRPHILEKFLPDNPEAVARIRETFAGLYSLDTGEEGDEAVKAALANPDQFVLKPQREGGGNNLYGEELKAKLEECKDSEERNSYILMDKINPKTTKNCLLRAGGPVQISECISELGMFGVYVRRSGEMIYNEQVGHLLRTKAIEHADGGVAAGVAVLDNPYLV
Donor tissue: tailbud