ORFeome > gstt1 – XORFeome 2.0

gstt1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis glutathione S-transferase theta 1, mRNA (cDNA clone MGC:79730 IMAGE:6982488), complete cds
Gene Symbol: gstt1
Gene ID: 448525
ORF gb_acc: MG133670
ORF ID: 11224

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076690

Library Location

Plate ID: GDExt11012
Well Location: D06

EST Sequences

Clone: MGC:79730 IMAGE:6982488
Trimmed Sequence: ATGGCTGAGCTCACACTGTATCTGGATCTGCTGTCCCAGCCCTGTCGCTCCGTCTACATTTTCGCCAAAGCCAATAACATCCCGTTCAACAACCATCAAGTGCGGCTTTTTAAAGGGGAGCATCTTACTGAGGAGTATGGGAAAGTGAATGTGCTACGCAAAGTGCCTGCTCTGAAAGATTGCGACTTCTTTATGGCTGAAAGCACTGCAATGCTGCTCTACATGGCACGCAAATTTAAAACTGCTGATCACTGGTACCCATCAGATATACAGAAGTGTGCCAAAGTTGATGAATACCTTGCTTGGCAGCACACTAACACCCGACCCAATGGTTCCAAGGTCTTCTGGGTCAAGTGTTTGACACCACTAATACTGGGCCAAGAAGCTCCTGCTGAAAAAGTAGATGCAGTAGTGGCAGAATTCAACACCACCATGAACAATTTTGAAGAAAAATTCCTGGGGAACAAACTCTTCATTGCTGGGGATGAGATCTCTGTGGCAGACCTGGTGGCCATTGTGGAGATTATGCAGGTGGTGGCAGGGGGCATAAATGTATTTGATGACCGACCAAAGCTGGCAGCCTGGAAGAAACGGGTAGTAGAGGCTTTGGGTGAAGAGCTCTTTTTGGAGGCACATGAGGGCATCCTTAATGCTAAGAAAATGGCAAGTGAACCTTTAGCCCCTGAACTTATGGAATTTCTGAAATCCAAGTTACTATCCATGAAGTGA
Full Trace Sequence: ctgactatacgcaatggctgagctcacactgtatctggatctgctgtcccagccctgtcgctccgtctacattttcgccaaagccaataacatcccgttcaacaaccatcaagtgcggctttttaaaggggagcatcttactgaggagtatgggaaagtgaatgtgctacgcaaagtgcctgctctgaaagattgcgacttctttatggctgaaagcactgcaatgctgctctacatggcacgcaaatttaaaactgctgatcactggtacccatcagatatacagaagtgtgccaaagttgatgaataccttgcttggcagcacactaacacccgacccaatggttccaaggtcttctgggtcaagtgtttgacaccactaatactgggccaagaagctcctgctgaaaaagtagatgcagtagtggcagaattcaacaccaccatgaacaattttgaagaaaaattcctggggaacaaactcttcattgctggggatgagatctctgtggcagacctggtggccattgtggagattatgcaggtggtggcagggggcataaatgtatttgatgaccgaccaaagctggcagcctggaagaaacgggtagtagaggctttgggtgaagagctctttttggaggcacatgagggcatccttaatgctaagaaaatggcaagtgaacctttagcccctgaacttatggaatttctgaaatccaagttactatccatgaagtgaatatggtgtccattcatcagatgaatttgctgcagccctgagccagagctgttgagcttatagtttcagtgtatcttgatgttataccacttctttctgtctaaacatacaaggaggatgcttccttttaataaataatcaaaaacaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAELTLYLDLLSQPCRSVYIFAKANNIPFNNHQVRLFKGEHLTEEYGKVNVLRKVPALKDCDFFMAESTAMLLYMARKFKTADHWYPSDIQKCAKVDEYLAWQHTNTRPNGSKVFWVKCLTPLILGQEAPAEKVDAVVAEFNTTMNNFEEKFLGNKLFIAGDEISVADLVAIVEIMQVVAGGINVFDDRPKLAAWKKRVVEALGEELFLEAHEGILNAKKMASEPLAPELMEFLKSKLLSMK
Donor tissue: tadpole