ORFeome > hccs – XORFeome 2.0

hccs – XORFeome 2.0

General Information

Species: Xenopus tropicalis holocytochrome c synthase (cytochrome c heme-lyase), mRNA (cDNA clone MGC:88926 IMAGE:6999905), complete cds
Gene Symbol: hccs
Gene ID: 448226
ORF gb_acc: MG134017
ORF ID: 11631

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075286

Library Location

Plate ID: GDExt11016
Well Location: E04

EST Sequences

Clone: MGC:88926 IMAGE:6999905
Trimmed Sequence: ATGGGAGCTTCAGCTATAAACCCATCAAGTATTCCTTCACAATCATCTACTGAATCAGCAAAGACCCACCCAGCAGAATGTCCAATGCATCAGAAGAAGATGGAAGGCTGTCCCATGCACAAGGAATCTATACAAAATACAGAAAACTGTTCTGGGCCTACACATCAAGAAGAGGCCTATAGATATGTTCAGTGTCCAATGAGATCAGGAGTAAAGGATGACATTGATCCCAGCAATATGATGCCACCTCCAAATCAGACTCCAGCTACTGACCAGCCATTCAGTTTGTCTCTGGCAAGAGAAGAATCCACCATTCCACGATCCAGCACTGACAAGAATTGGGTGTACCCATCTGAACAGATGTTTTGGAATGCAATGTTAAGGAAGGGATGGAGGTGGAAAGAGGATGATCTTAAACCAGAAGATATGACAAACATTATCAGAATTCACAACAAGAACAATGAACAGGCGTGGTCAGAAATTCTAAAGTGGGAAGCCCTCCATGCCAAAGAATGCCCTTGTGGCCCTACATTGGTTCGGTTTGGCGGAAAAGCAACGGAGTATTCTCCGAGAGCACGGATGCGCTCATGGATGGGGTATGAGCTTCCATTTGATCGTCATGATTGGATTGTTGACCGCTGTGGAAAAGAAGTTCGATATGTCATTGACTATTACGATGGAGGTGAAGTTGATAAGAACTATCAGTTCACAATTTTAGATGTCCGTCCTGCATTTGACAGTATGGGTGCGATCTGGGACAGAATGAAAGTGGCTTGGTGGCGCTGGACATCATAG
Full Trace Sequence: ctgcgctccggtaaagggcagctgacatgggagcttcagcatcaactccatcaagtgctcctccacagtcatctactgaatctgcaaagacctactcagcagaatcacctccccctgaatgtcccatgcatcagaagaagatggaaggaatgggagcttcagctataaacccatcaagtattccttcacaatcatctactgaatcagcaaagacccacccagcagaatgtccaatgcatcagaagaagatggaaggctgtcccatgcacaaggaatctatacaaaatacagaaaactgttctgggcctacacatcaagaagaggcctatagatatgttcagtgtccaatgagatcaggagtaaaggatgacattgatcccagcaatatgatgccacctccaaatcagactccagctactgaccagccattcagtttgtctctggcaagagaagaatccaccattccacgatccagcactgacaagaattgggtgtacccatctgaacagatgttttggaatgcaatgttaaggaagggatggaggtggaaagaggatgatcttaaaccagaagatatgacaaacattatcagaattcacaacaagaacaatgaacaggcgtggtcagaaattctaaagtgggaagccctccatgccaaagaatgcccttgtggccctacattggttcggtttggcggaaaagcaacggagtattctccgagagcacggatgcgctcatggatggggtatgagcttccatttgatcgtcatgattggattgttgaccgctgtggaaaagaagttcgatatgtcattgactattacgatggaggtgaagttgataagaactatcagttcacaattttagatgtccgtcctgcatttgacagtatgggtgcgatctgggacagaatgaaagtggcttggtggcgctggacatcatagcctgtttgcctctgaaagtcatctgaaacattggagctgctttaacacaaaacaagatcagacaagtgcaagaaagtggacttttataagtgcaatttgaaaaaaaaataactcctgtatttaagtgatatcatatacatacaaaggcttttaaaaataaaatacttggtttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGASAINPSSIPSQSSTESAKTHPAECPMHQKKMEGCPMHKESIQNTENCSGPTHQEEAYRYVQCPMRSGVKDDIDPSNMMPPPNQTPATDQPFSLSLAREESTIPRSSTDKNWVYPSEQMFWNAMLRKGWRWKEDDLKPEDMTNIIRIHNKNNEQAWSEILKWEALHAKECPCGPTLVRFGGKATEYSPRARMRSWMGYELPFDRHDWIVDRCGKEVRYVIDYYDGGEVDKNYQFTILDVRPAFDSMGAIWDRMKVAWWRWTS
Donor tissue: