ORFeome > hdgf – XORFeome 2.0

hdgf – XORFeome 2.0

General Information

Species: Xenopus tropicalis hepatoma-derived growth factor (high-mobility group protein 1-like), mRNA (cDNA clone MGC:69306 IMAGE:5308636), complete cds
Gene Symbol: hdgf
Gene ID: 549761
ORF gb_acc: MG134253
ORF ID: 11914

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090580

Library Location

Plate ID: GDExt11019
Well Location: A06

EST Sequences

Clone: MGC:69306 IMAGE:5308636
Trimmed Sequence: ATGTCCCGCTCCAACAGGCAGAGGGAGTACAAGTGTGGGGACCTGGTGTTCGCCAAAATGAAGGGCTACCCCCACTGGCCTGCTAGGGTTGACGAAGTCCCAGAACCCAACGCAAAGTCATCCGCTAATAAATATCAAGTGTTCTTCTTTGGGACGCATGAAACGGCATACCTCGGTTCTAAAGATATCTTCCCATACGAGGAAACTAAAGAGAAGTATGGCAAGACTAACAAGAGGAAAGGATTCAGCGAAGGCCTCTGGGAAATTGAAAATAACCCCACAGTGAAATCATCTGGACACCAGCCATCCCGAAAAAGAAGCTCTACCACAAAAGCTGGGCGTGGAGGTGGAGCCAAAAATAGTGGAAAGGCAGCCAGAAAGAAGAACCTTGAAGAGGATGAAGATGCAGATGCCGATGCAGAAGAGAAGGAGGAAGCCGACAGCGAGAAGAAGGGAAATGCGGAGGGCAGCAGCGATGAAGAGGGAAAACTCGTGATAGACGAACAATCCAAGGAGAAGAGTGACAAGACAGCAAATAAACGAAAAGCAGAGGATACCGCAGAGAGCTCCCCAAAAAAAGCAAAAGTAGAGGATGATAAAGAGCCCGAGAAAAATGAAAAAGAGGAATCCAATGAGGAAGAGAGAGTGCAAACGCCGGAGGCAGGCAAAGAGAAGAACCGTGAACCCCCCAAACCTGCAGAGGACTCTGGAAAAGAAAAGGTAGAAGAGAAGCCAGCTGTAGGGGAAGAGACAAAAGAGCAGAAGGAGAGCCTGTAG
Full Trace Sequence: caccgccggacaccgacacccccgccgtcactgggcagcagtcagcaaaggcctcaagccgtgtcctcacgtagcagccattgccgctccgggtattcctgcgccagcctgaccttccgtgcaagcagtgtgcctgcctctttctcggcgcctttcccgctctttccctgtaacccgcccgcgtcgtgaggaggaggagaagctgctgtgcccgagtgtctccgccatgtcccgctccaacaggcagagggagtacaagtgtggggacctggtgttcgccaaaatgaagggctacccccactggcctgctagggttgacgaagtcccagaacccaacgcaaagtcatccgctaataaatatcaagtgttcttctttgggacgcatgaaacggcatacctcggttctaaagatatcttcccatacgaggaaactaaagagaagtatggcaagactaacaagaggaaaggattcagcgaaggcctctgggaaattgaaaataaccccacagtgaaatcatctggacaccagccatcccgaaaaagaagctctaccacaaaagctgggcgtggaggtggagccaaaaatagtggaaaggcagccagaaagaagaaccttgaagaggatgaagatgcagatgccgatgcagaagagaaggaggaagccgacagcgagaagaagggaaatgcggagggcagcagcgatgaagagggaaaactcgtgatagacgaacaatccaaggagaagagtgacaagacagcaaataaacgaaaagcagaggataccgcagagagctccccaaaaaaagcaaaagtagaggatgataaagagcccgagaaaaatgaaaaagaggaatccaatgaggaagagagagtgcaaacgccggaggcaggcaaagagaagaaccgtgaaccccccaaacctgcagaggactctggaaaagaaaaggtagaagagaagccagctgtaggggaagagacaaaagagcagaaggagagcctgtagctgtcacgatcacccctttccccctcctggctgggcagaatccattcatcatttttattatactctcgggcgcttaaaaaaagaaaaaaaaaagaagaaaaatagggatgaaacactcatctatcaatatctacaaccctttaagtccatctcatcatgggagacctctcaaacggcatcttggactcttatttaaaaacaaaaggcttctaatggcatcttgggactctgatgcaaccttttgccttttttattcccccccccttcccagttttaatgtgttgctgttctctgtgccagtacaaacttgcaaaattgttcaatcccagtgctctctgtctctgctttgtgctccgtgacgcccgctcatccttgattggtccctagcagcggccattcatttatattacttttctttttttctagcaaaggcctctctgggccagttctcaaaccagattgtttgcccttaatgtgctgtgggcaaaataggtgataatctataaccgggtctgttggaaacatttaacttttaagacagaacttaactattaacccttacacggtcggtagttggctgccagttttagcagcaatgaaacctttacttcatgggtcgcaacagcttccatggtggcaaatagaggaatcctagccggtaactacattggcagtacagaaatggtatctctgcgggcagcagcactattttattgtgctttttttttttttgtatcaggatttggcagccgtctccattttattttcattagggttaatcacaacagctgaaaagcaattgagggtttttacatttagaactggacatatttatgtagaatctgtctttattgtataaatcgtgccccctccaatggctttacacctttctaggctgcttgtttttgttaaaaaaaaaacaaaaaacgttctgcgaagtaaatgtctctttattcagaatttgacacattactgcttgcttgggcagactcttggaattggggtctcctgtgatttctctgcaatgttgtgtttgtgtattcctgctagttctctcggatatggtatattcaatctgactccagttctccaggccacgtaatggtataacccaccgcaaaccactacatcgcaggaatcggatcttggtttaaataggaacgatctccttccccgttttctagattagttaaggaaaagcaaagttggtcctaatttggaagggcacccctcctgggaaaatggaagaggctgacggggagggcagtgtttagaagaaagtaccctggaccgtggcatttttaatgcaggctcagtttgcatagcaggcaggtacagtcatttgcccactaacagggcaacttgtgctgctaaaccccagctgcaaggcttgggagtagtcagtgggcagccaatgggatttaggcattgctgactattaacctgtcagcctccctattaactgactattaacctgtcagcttctgtaagatgtatttgctcttccaaagatttgccatttatatcatctcctttgcttcctacaatcaagtatttggccctttttccttaaggggaggggctttggcaggtctgttcttgttcatttaggttttgttcatatttttttttttgttttgctctgtgatgcaatttgctgtcaacatgtcgatccaaggtaggaatctgaataaatgttgcccaggtgagtgccagagcgagaagtctgtacagtcccatcctcggccacagtgtaaatatttccttcattgatcccccccccacatcatcggcctttagatacttgtatccatattcatagcgcaaatctctaatcgcaccttgaatgttggcggttgttggagccccccagcggttccctcgcggcagcctctacctaaccccgcccactgcgtcatgtgctttctttctcattggcagatttcaatctcacattcattttatgcgctaatctgcttcataaactatatatgggtcaaacggattgaaaaccagattttgtagttaacatttttaataaaacaaaaagcggcaaaaaaataccctgacttacagaagctacgacctcgccgacggtatcttttagttgtcatttttattgttcttttaacccccccccccccttcctttttgcccccagttctccgacttgtctttttatggctatgtgatgtaatcataccgtttgtaacatagacgtgggaaaatttacaacatgccccagttttttttctgttttggaattttattttcatttttgttttttggcggctgtgatgaaggcaattgttaaaaaaaaaaaaaaaaaaattagcttttggtatagttctgaaaactgtagatttcagttctttaggacaaataaacagattattataaaactgaaacaaaaaaaaaaaaaaaaaa
Translation: MSRSNRQREYKCGDLVFAKMKGYPHWPARVDEVPEPNAKSSANKYQVFFFGTHETAYLGSKDIFPYEETKEKYGKTNKRKGFSEGLWEIENNPTVKSSGHQPSRKRSSTTKAGRGGGAKNSGKAARKKNLEEDEDADADAEEKEEADSEKKGNAEGSSDEEGKLVIDEQSKEKSDKTANKRKAEDTAESSPKKAKVEDDKEPEKNEKEESNEEERVQTPEAGKEKNREPPKPAEDSGKEKVEEKPAVGEETKEQKESL
Donor tissue: gastrula