ORFeome > idh3a – XORFeome 2.0

idh3a – XORFeome 2.0

General Information

Species: Xenopus tropicalis isocitrate dehydrogenase 3 (NAD+) alpha, mRNA (cDNA clone MGC:76128 IMAGE:5309202), complete cds
Gene Symbol: idh3a
Gene ID: 394979
ORF gb_acc: MG132746
ORF ID: 10049

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064220

Library Location

Plate ID: GDExt11001
Well Location: D05

EST Sequences

Clone: MGC:76128 IMAGE:5309202
Trimmed Sequence: ATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAG
Full Trace Sequence: gaacatggctggcagcgcctggaggtcactgatctctcgtgtggcgggggcactcactgcaccagaatatggagccaggcagctttctaaccatgtgcagactgtcactcttataccaggggatggaattggcccagagatttcaacagctgtcatgaaaatttttgagactgccaaagcacctgtacagtgggaagagagaaatgtcacagcaattaaaggccctggtggaaagtggatgattcctcctgaagccaaagaatccatggataagaacaagatgggcttaaaaggacctttaaagacacccattgctgctgggcatccgtccatgaacttgctgctccgcaagacatttgatctctatgcaaatgtgcgaccctgtgtttctattgagggctacaggaccccatacacagatgtagacctggtcacaattcgtgagaacacagagggagaatatagtggtatcgagcatgtgattgtagatggtgtggtgcaaagcattaagctgattacggaggaagccagccatcgcattgcacagtttgcctttgagtatgcaaggaacaaccagagaagcacagtgactgcagtgcacaaagctaatattatgaggatgtctgatgggctgttcctaaaaaaatgtcgagaagttgcagaaaactttaaagacattaaatttaatgaaatgtatctggataccgtgtgtcttaatatggtccaggatcctacccagtttgatgtgttagtcatgccaaacctttatggtgacatcttgagtgacctttgtgcaggtttaattggaggcctgggagtgacgccaagtggaaatattggtgctaatggggtagcaatctttgaatcggttcatggcacagctccagatattgctggaaaagacttggctaatcccactgctcttcttctaagcgcagtcatgatgttgcggcacatgggtctccacgaacatgcacgcaaaatagaaaatgcttgctttgagacaatcaaatctgggaaggctctgactaaagacttgggtggtaactccaagtgctctgaatttaccaatgaaatctgtcgcagaatacaggacagtgattagctttgcatctattgatttacttctgtccaaatggtcagctgaattgacaagcacataatttcctgctgtctttgatatgcatcagtgcttcatcttcatcccagcaaaccaaaagccctgctatgcatggcatgctacccagtgtgtataggcttctctggcagtgcaagattccagtgggtaaacacgagtggaatctcagattcataatgcagtgatcatcaattagaatcaatgcagcaatgctgattagaatcaaagtttatacatatactgacagtcgtatttttgtcaattacgcagcttttaccaaggccagttttgtgatttatccttatgccaagcattccctttttcagcgcacactgaatttgttgtatttaaacatggaatatatatccatggatgttcatttgcataaccaaacttgttctatccttatataacattactactgtaacaagatatggtttgtattactgctgcagttagaactgctgcagtaaaaatattggctatacatgaggtctttcagtggttgctcattaactggtgcccagcagaggatgcttgttgtcaaggagctaaacaacatgccagaatcctgaaataactgttataaatgtcatgttcaagccttaaacattgtaatttagaatttatatttatttataatttcactccatttttcctgtgttttttttttcttgctattatgcactttgtgttttgcattttcattaaatgtgcaaagtcaaagagacatttgaatgtcaaaaacctgatgcagataagtatgttttgttataggagaaatagttaattggtgacagctcataaagcttttatttttaaacccgttaaaatatagaaaaaaaaaaaaaaaa
Translation: MAGSAWRSLISRVAGALTAPEYGARQLSNHVQTVTLIPGDGIGPEISTAVMKIFETAKAPVQWEERNVTAIKGPGGKWMIPPEAKESMDKNKMGLKGPLKTPIAAGHPSMNLLLRKTFDLYANVRPCVSIEGYRTPYTDVDLVTIRENTEGEYSGIEHVIVDGVVQSIKLITEEASHRIAQFAFEYARNNQRSTVTAVHKANIMRMSDGLFLKKCREVAENFKDIKFNEMYLDTVCLNMVQDPTQFDVLVMPNLYGDILSDLCAGLIGGLGVTPSGNIGANGVAIFESVHGTAPDIAGKDLANPTALLLSAVMMLRHMGLHEHARKIENACFETIKSGKALTKDLGGNSKCSEFTNEICRRIQDSD
Donor tissue: gastrula