ORFeome > impad1 – XORFeome 2.0

impad1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis inositol monophosphatase domain containing 1, mRNA (cDNA clone MGC:89722 IMAGE:7026921), complete cds
Gene Symbol: impad1
Gene ID: 548969
ORF gb_acc: MG133087
ORF ID: 10504

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080464

Library Location

Plate ID: GDExt11005
Well Location: A05

EST Sequences

Clone: MGC:89722 IMAGE:7026921
Trimmed Sequence: ATGGCCCCTATGGGTATCCGTCTCTCCCCGCTGGGAATCGGAGTGTTCTGCTTGCTGGGGCTGGGAGTGCTGTACCATGTATACTCGGGCTTCCTCACCGGCAAGTTCTCAGCCTTCCTCCTGGGGGACAGAGCGGAGGATCCCGGGCCCGGGGAGGACACAGTGGATCTGAGGGAGCTGCTGGCTGTGTCGGTGCGGGCTGCGGAGCTTGGGGGGCTGGAGGTGAAGAAGGTCCGGGAAAGTAACTCGCTCAATGAGAAGGCGAAGGGCAAAACCATGGAGGGGGCGGACGACAAGATGACCAGTGGGGATGTGCTGTCCAATAAGAAAATGTATCACCTCATCAAAAATGCCTTCCCGGCCCTGAAGGTGAACACTGAGGAAAAAGTTGAAGCAGATGATGAAGATGCGGTCTCTTGGGATCGTAATATTCCTGATGATATAAAGGAGCAAATAAAGACAAAACATGTTGCATCTGAAAGCATTACAATGTGGATAGACCCACTAGATGCAACACAGGAGTATACAGAAAATCTGGTAAACTATGTGACTACCATGGTATGTGTCGCTGTAAATGGCAAACCTGTTATTGGCGTAATCCATAAACCTTTTACAGGTTTTACTGCATGGGCCATGTTGGATGGAGGTTCAAGTATAAAGAAACGAAATTCATACAATGAGAAAACTCCCACTTTTATTGTGTCACGTTCTCATTCGGGAGAAGTGAAAGAGGTCACCCGGCAAACATTTGGTAACAAGACAGAAATCATATCAGCAGGAGGAGCAGGTTACAAGGTTCTTTCACTGCTGGATGTGACTGATGATAAGCAAGAAACTGCTGATGTGTATATTCACGTCACCTACATTAAGAAGTGGGACATTTGTGCTGGCAATGCAATCCTAAATGCACTTGGAGGTCAAATGACTACTCTTAAAGGAGAAGAAATTATGTACACAGGATCAGAACTGAATAAAGGGGGGCTGCTAGCCAGCATTGGAATGGACCACGGTGTGCTTGTTGAAAAATTAGCTGAAAAATTACAAGTTAATGCTAAGAAACCAGCCAAGTAA
Full Trace Sequence: acttcctaattcgctatggcccctatgggtatccgtctctccccgctgggaatcggagtgttctgcttgctggggctgggagtgctgtaccatgtatactcgggcttcctcaccggcaagttctcagccttcctcctgggggacagagcggaggatcccgggcccggggaggacacagtggatctgagggagctgctggctgtgtcggtgcgggctgcggagcttggggggctggaggtgaagaaggtccgggaaagtaactcgctcaatgagaaggcgaagggcaaaaccatggagggggcggacgacaagatgaccagtggggatgtgctgtccaataagaaaatgtatcacctcatcaaaaatgccttcccggccctgaaggtgaacactgaggaaaaagttgaagcagatgatgaagatgcggtctcttgggatcgtaatattcctgatgatataaaggagcaaataaagacaaaacatgttgcatctgaaagcattacaatgtggatagacccactagatgcaacacaggagtatacagaaaatctggtaaactatgtgactaccatggtatgtgtcgctgtaaatggcaaacctgttattggcgtaatccataaaccttttacaggttttactgcatgggccatgttggatggaggttcaagtataaagaaacgaaattcatacaatgagaaaactcccacttttattgtgtcacgttctcattcgggagaagtgaaagaggtcacccggcaaacatttggtaacaagacagaaatcatatcagcaggaggagcaggttacaaggttctttcactgctggatgtgactgatgataagcaagaaactgctgatgtgtatattcacgtcacctacattaagaagtgggacatttgtgctggcaatgcaatcctaaatgcacttggaggtcaaatgactactcttaaaggagaagaaattatgtacacaggatcagaactgaataaaggggggctgctagccagcattggaatggaccacggtgtgcttgttgaaaaattagctgaaaaattacaagttaatgctaagaaaccagccaagtaaaggataactgaaataaattcctacattgcgcgttatgactttggcttgatgtgttaactagaatacgcgaggccagcatgtgaaagacagggaattgcagtgctgctctaatatggcagtgaaggactatgggctccaggagttttccttctgtatgcttcagtgcaaggtgcaatatactgcaagtaccccaactgtcttattaggacttcaaagacattgttggctttggatatggacggtgcatttcatgaacatgtaaatctgtaaagtctgatttcaagcagaatatgaatagaagtttaattttgcctaattaaagttgcgtcaatagacggcctttattcttttttttttttaattccaatttctcattagcctgattaacaaaaacaatcattgtgccttgttgctgacttaaaagtatagacatcttgcgacttaaacctatcctgatgaatacaatgttttattcattgtagtgtttttgtctagagcttgaataatgggtttttttctgttcaagtagcagccacgtctgtattgtatagagaaatactgcaaagtcattactaattaataatgcatattctatcacataggaattcattgtttcaccaggactgtgtgtacatctcattgtaggcgcactgcttccctacactcccttaactgtgtgttttctctttgggttttaactgtaaatggaacctattcaattttggaggcattctagatgttaataagataataaatcactgtcattttgaaaaaaaaaaaaaaaa
Translation: MAPMGIRLSPLGIGVFCLLGLGVLYHVYSGFLTGKFSAFLLGDRAEDPGPGEDTVDLRELLAVSVRAAELGGLEVKKVRESNSLNEKAKGKTMEGADDKMTSGDVLSNKKMYHLIKNAFPALKVNTEEKVEADDEDAVSWDRNIPDDIKEQIKTKHVASESITMWIDPLDATQEYTENLVNYVTTMVCVAVNGKPVIGVIHKPFTGFTAWAMLDGGSSIKKRNSYNEKTPTFIVSRSHSGEVKEVTRQTFGNKTEIISAGGAGYKVLSLLDVTDDKQETADVYIHVTYIKKWDICAGNAILNALGGQMTTLKGEEIMYTGSELNKGGLLASIGMDHGVLVEKLAEKLQVNAKKPAK
Donor tissue: