ORFeome > insm1 – XORFeome 2.0

insm1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis insulinoma-associated 1, mRNA (cDNA clone MGC:121580 IMAGE:7620294), complete cds
Gene Symbol: insm1
Gene ID: 779614
ORF gb_acc: MG136291
ORF ID: 14657

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC135650

Library Location

Plate ID: GDExt11044
Well Location: A03

EST Sequences

Clone: MGC:121580 IMAGE:7620294
Trimmed Sequence: ATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCGGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGGGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAGCTCCCCCGGCCTGACCCGCCACATCAACAAGTGCCACCCCTCCGAGAACCGGCAGGTCATCCTGCTCCAAGTGCCGGTGCGCCCGGCCTGCTGA
Full Trace Sequence: aagccgtgcagctgcagcacctcggacagtgcaggagagcgggaggcacagcagcacctcggacagtgccagacagccgcttattaactattaactccccacactccctgagacactccttcgcaccaacatgcctaaagggtttctggtgaaacgcagcaggaagtccccgccggtgtcctaccgggtgcgggaagaagaagagccccgcggggagtcgctcccgggatggatgctcttagctacaatgtgcccgaccggtggggccccgccgccctgcagcccagacagagccacccaggccccatgctgcagcagcccccggccgccccccgccggtcagttcgggaacccggacacagtgcagcaggctctgtacagcccgacccgcccggtgagcagggagcagcgggaaaggaaatacctgggatccccggtgtctgcggagtcctttccgggcctgggcacctccagcgaagcgctactctaccctcccacaggcactgccaatgggcatcacggactggcactgctgcccccggtctcttcctcctcttcagtcagccgaagccaaggcaagaggccggccccggagcccgacagcaagcccgccgctatgcccggcactggcccaggggccacaagcagctcggcccccagcaagccccctgcggccaagaaaaccaaagccatccgcaaactgacctttgaagacgaggtgaccacatccccggtgctgggtctgaaaatcaaggaaggaccggtggagcccccccgccccagggcagccagctccgggccccgacccctgggggagttcatctgccaactgtgcaaggaggagtacagcgaccccttctccctggcgcagcacaaatgctccagaatcgtgagggtcgagtaccgctgcccagagtgccacaaggtgttcagctgcccggccaacttggcatcgcaccgccgctggcacaagccccgacccccagtcgcctccacagcccaagccaaggaggagccactgagtgaccgggacacccccagcccaggggtctccgagtccggctcagaagatgggctgtacgagtgcccccggtgtgcccgcaagttccgccgccaggcttatctgaggaagcacctgctgtcgcaccaagcagccaaggagccggaggagcccggtgtcatgatgttcccgggggaggagcagcgagccaagagcccccccagcctgaatgcccaggagtgccacccgtgcccggtgtgtggggaaacattcccggggaagagcagccaggagcgccacatccgcctcctccactcctcccagctgtacccctgcaagtactgccccgccaccttctacagctcccccggcctgacccgccacatcaacaagtgccacccctccgagaaccggcaggtcatcctgctccaagtgccggtgcgcccggcctgctgactttgtggggacttgttccaaggagaaatgtaggggtgtgcccacccctcccccacatggacctgacgggggccccaaaatgagaatattgcaccaattgtaagtgccggggggctgcagcatattgcggggcagtgtgttgtctctctcaggcacttatggaatcagatactttgggccaatgggcacagaggtcacaaggtgcccctaaagggccaataaaacggaccatcttgcactaatggggcgagggaagtgccgctagccatgcctgctgccccccccggtgcccacccaacccccacacaggtttccaacaagcccccgctgtggctacgggactcgcatgcctgactagtactgtgccttcccggtgcatccaatgcccacagggcactgccacctgccaaatcagcgaccacagcagccataggcccaagtgcattacattgtggttattgtgctttaaagcgacccagagttatccgagtaacccctcagtgcccagggagcccgctatgcccaagtcatgcccatgggcactgaggggagacggaatgggaagggagagcactttctgctttatttattgtgttgataatattctctgtgtccgtgctaaatgcctgtgcaaggattctacagtaagttatgtatgttgtcccattggcctcatagagacagcgctgagccatagcggggctagtgctgctgcctgtgagagctcagatggggcaacgctttagggtgggggaggggtgggcaagccatatgctcactgtactttttaaaaatgtcagatcgcagggtttgtcatgtaattgatgtgcttaacccctaaaatgctggagggagctgcggtaattcgcagagaagcccctgcccaatctggctgcgtttaacccgtcactgccatttgggagagcccttctagcagcagtttatgtcgcctgtgcttttgtagcctttcctcttgtcttgatataaatgtgctttctagcctaaggggttaatgttctgccttgatgccccccggcctgcacacaactataccattagctttatacactggccggggggctgctcagctctgtctttctctcttctcagccccagctgtggattttggggggggaggaggagactttactttagtcttagccacaaatgccttgaagtcattattgtctctttaataactctggagtaagctgtagcgactgcctggtcccccccagtgtagggacccacaatccatcccaatacagggatcctggctacattaaatcaactttttgtcacgtgttttgtcccccccccctctaaaatatctttctgtatgcccccccccatgcgtttactatccaaaatgtatatgttgattttatgattaattatgtttatttatttttatttatttatgagaatgatgaagatatgacttttattcgatctctttcattgcctagatatataaatatatatattttgccatgacttctcactgtggatttcagccttttctttgctttaatacaactgaatgatgagagaatgtagatctgggcacattccggaccttgagggcagccagcgctccgaccttattatagctcttatgtctagagaaatctcttttgtacacaacattattttcctaactgtaataggcatttatagagtgcttcaatagaactgttctactgtgtaacgatttgctattcaaataaaattattttccaattcaaatcaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPKGFLVKRSRKSPPVSYRVREEEEPRGESLPGWMLLATMCPTGGAPPPCSPDRATQAPCCSSPRPPPAGQFGNPDTVQQALYSPTRPVSREQRERKYLGSPVSAESFPGLGTSSEALLYPPTGTANGHHGLALLPPVSSSSSVSRSQGKRPAPEPDSKPAAMPGTGPGATSSSAPSKPPAAKKTKAIRKLTFEDEVTTSPVLGLKIKEGPVEPPRPRAASSGPRPLGEFICQLCKEEYSDPFSLAQHKCSRIVRVEYRCPECHKVFSCPANLASHRRWHKPRPPVASTAQAKEEPLSDRDTPSPGVSESGSEDGLYECPRCARKFRRQAYLRKHLLSHQAAKEPEEPGVMMFPGEEQRAKSPPSLNAQECHPCPVCGETFPGKSSQERHIRLLHSSQLYPCKYCPATFYSSPGLTRHINKCHPSENRQVILLQVPVRPAC
Donor tissue: embryo