ORFeome > irak1 – XORFeome 2.0

irak1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis interleukin-1 receptor-associated kinase 1, mRNA (cDNA clone MGC:89216 IMAGE:7017424), complete cds
Gene Symbol: irak1
Gene ID: 448357
ORF gb_acc: MG134165
ORF ID: 11800

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075439

Library Location

Plate ID: GDExt11017
Well Location: F12

EST Sequences

Clone: MGC:89216 IMAGE:7017424
Trimmed Sequence: ATGTCCAGAGGCTCCTTCGAGGAGGAATTTCTGTACCGAGTCCCCTCTCAGGTCATGTACCGCTTCTTCCACATCATGGACTCCTTGGAGGAGACGGACTGGAAGAAGTTTGCTTCCATGATCATTCCAGACATGACTGAACTCCGGCTCCTGGAGCAGCAGGGATCTCGCTCTCGCACCGAGGAAGTCGTGTGGGCGTGGAGTAATAGAAATGCAGTGGTTGGGGAACTGCTGTCTATCCTCAGATCATTAAACCTGTTACGGGCCCTTGATGTCTTTGAATCCTGGAGATCAAGATACGTGCCAGAGAGTACACAGAACTTCTCTCAGGCAAACCCTTTGCCTCCTCCATATCCGTATCCAGGCCCTGAAAGCGCACCCTATTTCCAGAAGCCCCAGACAAAAACTGACAGCCTACAGACACAGGCTACTAATCCCTCAGACCTACCTCAGCAATTGCCTCTTCCCGGGCCCCCTCCAAAAGCATTTATCTGCTCTTCCCACAGCGCCAGCACAGGGGGCAGCAGTGATTGCTCTGGCAGCCAAATCCATTCTTCTGTGCAGGAATCCTTTCTACCCAGCGATGTACGTGATCTGCCAAGGCAGTTCGTTTGGCGCTTCCAGGAGCTGGTTGATGGCACGAGAAACTTCTCCCAGTCTCTGCTGATCGGGGAGGGCGGATTTGGCTGTGTGTATAAAGCGACCATGCGGAACACTGAGTATGCAGTCAAGCGGCTGAAGCAGGACTCCGAGCTGGAGTGGAGCACAATGAAGAAGAGTTTCCTTACGGAGATAGAGAAACTGACTTGCTTACGGCACCCAAACATAATCGACCTGGCAGGATATAGCTTCCAGGGGGAAGAATATTGCCTTATTTATCTTTATCTACCCAATGGTTCTTTGGAAGACCGGCTGCACCCTCAGGGCAGATTTCCCAAACTCCCCATGGAGCAGCGGATTAGCATCCTGCAGGGAGCAGCTTGCGGCCTTCAATACTTGCACAACTATCAGCCCAGCATCATCCATGGGGATGTAAAAAGCTCCAATATTCTACTGGACCAAGCCTTCATGCCGAAACTGGGTGACTTTGGGCTCGCACGATTTAGTCGGTACACAAGCAACGCAGGCAACAGTCGCACGTTGGCACGGACCAGCACAGTGAAGGGTACCCTGGCATATCTGCCTGAAGAGTATGTGAAAATGGGGAAACTCACTTTTGAACTGGATACATACAGCTTTGGAGTTGTTCTACTGGAAAATCTGACGGGAAGGAAAGCTATAGAGAGTGACAGCAAGTCTCACACCAAGTATCTGAAGGATCTAGTGAAGGAAGAAGAGTGCAAGGATGAGGAGGAGGAAGAAAAAGGAGCCAGCATGGCAAGTGGAGCAGAAGCCAAGCTAGCACGGGTGGCAGCACGCATATGCCAATATCACCTAGATTTCAGAGTATGGCAGCACGCTAAAGAAGTAACGCAGGAACTCTCACAACTGGCGTGTCGGTGTCTGGGACGTCAAAAGAAGAGACCGAATATGCAGGAGGTCTTTCTCACCCTAAAGCGGCTACAAGAGCATCTCCACCGACGACATTTGGGAAAGGGTCATGGAATTTCTTTTACTCCACCTTGCGTATCCACCAGGCGAGGATTTTCCCCCATACATGAGCTGGCATCTAGTGTCCAGGATTTGCCTCTCACCCCTGAGGAAAACACAGACAAATATACTCCCTGTGGGCTTTCAGTTAAGGGCAGTGTTCAACCCTACACCCCAGCTCACACCCAGCACCAGGCCAAAGTGGACAGTTTATGCAGTTCATTTTCCTGCCAAAGCCTCAAAACATTTCGGGGCGCTCAGAACACACCAGTGGAGAGTGATGAAAGCTTCCCAGATTTTAGTGGCTCTGATAATTCAGCGGGACCAAGTGACCAACATATTCTCTACCCCAGCGGAGTGCAAGGGAGCATATCGCCTGTATTACCAAGGGTATCTGTCCAGGACCCAATTCCTCCTGTGCAGTACCAGAACCAATTAGCAGTTCAGCCCAGGCAGAGACATTACTGCAATGAACTGTCAGGAAGTGGCAGCTCAACATCAGGGGCATCCCAAGGTAGGCCCAGGGGGCGAGCAACACATTTTGAAGAACACGTGGCAGCACTATTGGTGCTTTAG
Full Trace Sequence: cgttgctgaggggaagtggctgatcagccggagttgctgcgggacagcggggcagtgcgcttgtgtctgggcggaggggccgggcttgctcaatggtttcacatcggacagacagtcaccatgtccagaggctccttcgaggaggaatttctgtaccgagtcccctctcaggtcatgtaccgcttcttccacatcatggactccttggaggagacggactggaagaagtttgcttccatgatcattccagacatgactgaactccggctcctggagcagcagggatctcgctctcgcaccgaggaagtcgtgtgggcgtggagtaatagaaatgcagtggttggggaactgctgtctatcctcagatcattaaacctgttacgggcccttgatgtctttgaatcctggagatcaagatacgtgccagagagtacacagaacttctctcaggcaaaccctttgcctcctccatatccgtatccaggccctgaaagcgcaccctatttccagaagccccagacaaaaactgacagcctacagacacaggctactaatccctcagacctacctcagcaattgcctcttcccgggccccctccaaaagcatttatctgctcttcccacagcgccagcacagggggcagcagtgattgctctggcagccaaatccattcttctgtgcaggaatcctttctacccagcgatgtacgtgatctgccaaggcagttcgtttggcgcttccaggagctggttgatggcacgagaaacttctcccagtctctgctgatcggggagggcggatttggctgtgtgtataaagcgaccatgcggaacactgagtatgcagtcaagcggctgaagcaggactccgagctggagtggagcacaatgaagaagagtttccttacggagatagagaaactgacttgcttacggcacccaaacataatcgacctggcaggatatagcttccagggggaagaatattgccttatttatctttatctacccaatggttctttggaagaccggctgcaccctcagggcagatttcccaaactccccatggagcagcggattagcatcctgcagggagcagcttgcggccttcaatacttgcacaactatcagcccagcatcatccatggggatgtaaaaagctccaatattctactggaccaagccttcatgccgaaactgggtgactttgggctcgcacgatttagtcggtacacaagcaacgcaggcaacagtcgcacgttggcacggaccagcacagtgaagggtaccctggcatatctgcctgaagagtatgtgaaaatggggaaactcacttttgaactggatacatacagctttggagttgttctactggaaaatctgacgggaaggaaagctatagagagtgacagcaagtctcacaccaagtatctgaaggatctagtgaaggaagaagagtgcaaggatgaggaggaggaagaaaaaggagccagcatggcaagtggagcagaagccaagctagcacgggtggcagcacgcatatgccaatatcacctagatttcagagtatggcagcacgctaaagaagtaacgcaggaactctcacaactggcgtgtcggtgtctgggacgtcaaaagaagagaccgaatatgcaggaggtctttctcaccctaaagcggctacaagagcatctccaccgacgacatttgggaaagggtcatggaatttcttttactccaccttgcgtatccaccaggcgaggattttcccccatacatgagctggcatctagtgtccaggatttgcctctcacccctgaggaaaacacagacaaatatactccctgtgggctttcagttaagggcagtgttcaaccctacaccccagctcacacccagcaccaggccaaagtggacagtttatgcagttcattttcctgccaaagcctcaaaacatttcggggcgctcagaacacaccagtggagagtgatgaaagcttcccagattttagtggctctgataattcagcgggaccaagtgaccaacatattctctaccccagcggagtgcaagggagcatatcgcctgtattaccaagggtatctgtccaggacccaattcctcctgtgcagtaccagaaccaattagcagttcagcccaggcagagacattactgcaatgaactgtcaggaagtggcagctcaacatcaggggcatcccaaggtaggcccagggggcgagcaacacattttgaagaacacgtggcagcactattggtgctttagggattgttacaaaaaatcattctatgtacagaacctatcccctttgtatttctgttatggaaatatcaaagttaattagttcccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSRGSFEEEFLYRVPSQVMYRFFHIMDSLEETDWKKFASMIIPDMTELRLLEQQGSRSRTEEVVWAWSNRNAVVGELLSILRSLNLLRALDVFESWRSRYVPESTQNFSQANPLPPPYPYPGPESAPYFQKPQTKTDSLQTQATNPSDLPQQLPLPGPPPKAFICSSHSASTGGSSDCSGSQIHSSVQESFLPSDVRDLPRQFVWRFQELVDGTRNFSQSLLIGEGGFGCVYKATMRNTEYAVKRLKQDSELEWSTMKKSFLTEIEKLTCLRHPNIIDLAGYSFQGEEYCLIYLYLPNGSLEDRLHPQGRFPKLPMEQRISILQGAACGLQYLHNYQPSIIHGDVKSSNILLDQAFMPKLGDFGLARFSRYTSNAGNSRTLARTSTVKGTLAYLPEEYVKMGKLTFELDTYSFGVVLLENLTGRKAIESDSKSHTKYLKDLVKEEECKDEEEEEKGASMASGAEAKLARVAARICQYHLDFRVWQHAKEVTQELSQLACRCLGRQKKRPNMQEVFLTLKRLQEHLHRRHLGKGHGISFTPPCVSTRRGFSPIHELASSVQDLPLTPEENTDKYTPCGLSVKGSVQPYTPAHTQHQAKVDSLCSSFSCQSLKTFRGAQNTPVESDESFPDFSGSDNSAGPSDQHILYPSGVQGSISPVLPRVSVQDPIPPVQYQNQLAVQPRQRHYCNELSGSGSSTSGASQGRPRGRATHFEEHVAALLVL
Donor tissue: