ORFeome > irx3 – XORFeome 2.0

irx3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis iroquois homeobox 3, mRNA (cDNA clone MGC:69450 IMAGE:5335930), complete cds
Gene Symbol: irx3
Gene ID: 407888
ORF gb_acc: MG133422
ORF ID: 10933

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067972

Library Location

Plate ID: GDExt11009
Well Location: D05

EST Sequences

Clone: MGC:69450 IMAGE:5335930
Trimmed Sequence: ATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTATACCCCTCGGACAGGCAGAACGTGGGGGGCACCAGGAGCGGAACTGAACTCTCTCCGGCCGGGACTCTTTCTAATGTTCTCTCCTCGGTGTACGGAACTCCCTACGCTGCAGCCGCCGCGGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGTTGGGCTCACAGTATGAAATGAAGGACAGTCCGGGGGTCCAGCATGCCGCCTTCTCCCACCCCCACGCAGCCTTTTATCCCTACGGACAGTACCAGTTTGGAGATCCGTCAAGGCCCAAAAACGCTACCAGAGAGAGCACAAGTACCCTTAAGGCCTGGCTCAACGAACACAGAAAGAACCCATATCCGACCAAGGGCGAGAAGATCATGCTTGCCATCATCACTAAAATGACCCTCACACAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCCAGGAGCCGAACTGATGAGGAAGGTAACGCTTACGGCAGCGACCATGAAGAAGACAAGCATGAGGACGACGAGGAGATTGACCTGGAGAACATCGACACTGAGGACATTGAGAGTAAGGAAGACTTGGATGACCCAGACACTGATATACACTCGGACTCTAAAACTGATGCCAGGAGTGACTCGGAAGCCTCGGATGGGTTTGAGGACCTGAATGCCCCTGAGGACAGACTTCTCAAGTCAGTGGTTGGTCAAAGGCAGGTGTTAAATGAGGAGCCCCAGGACAAGTGTGCACTTTCTTCTGATGCTAAAGCTTCCCAGCCTGCGTGTGAGCAGATCAAACTGGACAGAATCCCCTCTAGTCCTCCTCTGGAGAACAACATTCCCGCGGCCCACAAACCCAAAATCTGGTCACTGGCAGAGACAGCAACAACCCCAGATAACCCACGCAGGTCCCCCAACACGGGTGGCTCAGTGAACACTCAAAACCTGATTGCACAACACAGACTTATCGCCTCCCCAGGGAGCAGGTTCCAGGGTTGGACTGGAAGAGCATTCTCTGCTCAGCAGTTGTCTTTACTAAACTCTGCTCATTTTCTGCAAGGACTGAGCGTCTCTCACACAGCCCTGGGCTCTGGCACTGCAAGTTTCCCTAAGGCCGCCGAGCCCAAGCACAGCACAGACTCTCTAACAGATCGATCCAGTACAGTGGACATAGAGAAAAAAATACCTGTATTAAATACAGCTTTCCAACCAGTGCAACGAAGGTCACAAAATCAGCTGGACGCTGCCATGATCCTTTCCGCTCTATCCTCATCCTAA
Full Trace Sequence: gtgagactagaggacttgggaggagcttacgctgggcttgaaatgtcaatcacagtgtgagtgccaatgatctgaagcaatctgctaggaactgacctggtccacgcagatcaatagcaccagagggagaggacagagccaccgagatccctgctggaaccctagaagcccggttccccccttcctgggtcgcttgatgtgtagggagacgggcaagcaaactcaggtcatagaaggggattccctgcgcctccggctgcaccatgtccttcccacagctgggctaccagtacatcagacctctatacccctcggacaggcagaacgtggggggcaccaggagcggaactgaactctctccggccgggactctttctaatgttctctcctcggtgtacggaactccctacgctgcagccgccgcggcacaagcctatggagccttcctgccctacagcgcggagctgcccatcttcccccagttgggctcacagtatgaaatgaaggacagtccgggggtccagcatgccgccttctcccacccccacgcagccttttatccctacggacagtaccagtttggagatccgtcaaggcccaaaaacgctaccagagagagcacaagtacccttaaggcctggctcaacgaacacagaaagaacccatatccgaccaagggcgagaagatcatgcttgccatcatcactaaaatgaccctcacacaggtgtccacctggtttgctaacgcaaggaggagacttaaaaaggagaacaaaatgacttgggcccccaggagccgaactgatgaggaaggtaacgcttacggcagcgaccatgaagaagacaagcatgaggacgacgaggagattgacctggagaacatcgacactgaggacattgagagtaaggaagacttggatgacccagacactgatatacactcggactctaaaactgatgccaggagtgactcggaagcctcggatgggtttgaggacctgaatgcccctgaggacagacttctcaagtcagtggttggtcaaaggcaggtgttaaatgaggagccccaggacaagtgtgcactttcttctgatgctaaagcttcccagcctgcgtgtgagcagatcaaactggacagaatcccctctagtcctcctctggagaacaacattcccgcggcccacaaacccaaaatctggtcactggcagagacagcaacaaccccagataacccacgcaggtcccccaacacgggtggctcagtgaacactcaaaacctgattgcacaacacagacttatcgcctccccagggagcaggttccagggttggactggaagagcattctctgctcagcagttgtctttactaaactctgctcattttctgcaaggactgagcgtctctcacacagccctgggctctggcactgcaagtttccctaaggccgccgagcccaagcacagcacagactctctaacagatcgatccagtacagtggacatagagaaaaaaatacctgtattaaatacagctttccaaccagtgcaacgaaggtcacaaaatcagctggacgctgccatgatcctttccgctctatcctcatcctaacagtgtattttatatttatattttcttcttttttaactattcgaatgactgtaaaatatttctatgctgggtagtaacgccttgtaagcatgtctgtggataaaatggaacaaaaattgtttctattctcttatgcagaccagagttcgtatggtttgtcttgtgctaattaaacgtcggtcatttttgtatatatagtacaaatgtaaatatgtgtttaaaccaaattgtacaaataagtatatatttttggttaataaattcttcacaatttaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSFPQLGYQYIRPLYPSDRQNVGGTRSGTELSPAGTLSNVLSSVYGTPYAAAAAAQAYGAFLPYSAELPIFPQLGSQYEMKDSPGVQHAAFSHPHAAFYPYGQYQFGDPSRPKNATRESTSTLKAWLNEHRKNPYPTKGEKIMLAIITKMTLTQVSTWFANARRRLKKENKMTWAPRSRTDEEGNAYGSDHEEDKHEDDEEIDLENIDTEDIESKEDLDDPDTDIHSDSKTDARSDSEASDGFEDLNAPEDRLLKSVVGQRQVLNEEPQDKCALSSDAKASQPACEQIKLDRIPSSPPLENNIPAAHKPKIWSLAETATTPDNPRRSPNTGGSVNTQNLIAQHRLIASPGSRFQGWTGRAFSAQQLSLLNSAHFLQGLSVSHTALGSGTASFPKAAEPKHSTDSLTDRSSTVDIEKKIPVLNTAFQPVQRRSQNQLDAAMILSALSSS
Donor tissue: tailbud