ORFeome > jup – XORFeome 2.0

jup – XORFeome 2.0

General Information

Species: Xenopus tropicalis junction plakoglobin, mRNA (cDNA clone MGC:75867 IMAGE:5382915), complete cds
Gene Symbol: jup
Gene ID: 395011
ORF gb_acc:
ORF ID: 10421

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC064717

Library Location

Plate ID: GDExt11004
Well Location: F08

EST Sequences

Clone: MGC:75867 IMAGE:5382915
Trimmed Sequence: ATGGATTTGGTGGATGTAGTGGAAGTGCCAATAAAAGTCACAGAGTGGCAGAAAACCTACACTTACGACTCGGGCATCAATTCTGGAATAAACACAGCGTCTCCATCGTTAAACGGGAAAATGGTCATCGAGGACGACAGCCATGCCTACCCCGGCAGTTACACTGTTAAAACCACGACGTACACACAGCAGCAGACCCCAGACATGGACGCCCAGATAAACATGACTCGAGCCCAGCGCGTCCGAGCAGCAATGTACCCAGAGACGGTGGAAGATCACTCGTACCTTCTGACTACCCAGATAGAAGGGCAGCAAACCAACGTGCAGAAACTGGCGGAACCCTCCCAAATGTTGAAATCTGCTATCATCCACCTTATCAACTACCAGGATGATGCTGAGCTTGCCACCCGCGCCATTCCGGAACTGACAAAGCTACTTAATGATGAGGATCCGATGGTGGTGAACAAGGCTTCCATGATTGTAAACCAGCTGTCCAAGAAAGAGGCATCCCGCAAAGCCCTGATGCAGTCCCCGCAGATTGTTGCCGCTGTAGTTCGCACCATGCAGCACACAAGTGACATGGACACCGCTCGCTGTACCACCAGCATCCTGCACAACCTGTCCCATCACCGCGAGGGGCTTCTGTCTATCTTCAAATCCGGCGGCATCCCTGCACTTGTGCGCATGCTCAGTTCTCCAGTAGAATCCGTGTTATTCTATGCCATCACCACCTTGCACAACCTGCTGCTCTACCAGGAAGGGGCAAAGATGGCAGTGCGTCTGGCAGATGGTCTCCAGAAGATGGTGCCTTTGCTTAATAAGAATAACCCCAAATTCTTGGCCATCACTACAGACTGCCTTCAGCTCTTGGCCTATGGAAATCAGGAGAGCAAGCTAATTATATTGGCCAATGGAGGACCTCAAGGGTTGGTTCAGATCATGAGGAACTACAATTACGAGAAGCTTCTGTGGACCACAAGCCGGGTGCTAAAAGTATTGTCTGTGTGTCCCAGCAATAAACCAGCCATTGTGGAAGCCGGTGGAATGCAAGCACTGGGGAAACATCTGACCAGCAACAGCCCAAGACTTGTACAGAACTGCCTGTGGACATTAAGGAATCTCTCTGATGTGGCCACTAAACAGGAGGGCCTGGATAACGTTCTAAAGATCCTGGTGAACCAGCTGAGTTCTGATGATGTAAACGTCCTCACCTGTGCCACTGGCACATTGTCCAACCTCACCTGCAACAACGGTCGCAACAAGACTCTCGTGACGCAGAGCAACGGGGTTGAGTCTCTGATTCACACCATCCTTCGTGCGAGTGACAAGGATGACATTGCAGAGCCTGCTGTCTGTGCCCTGCGTCACCTGACCAGTCGCCACCAAGACGCAGAGGTGGCTCAGAATTCAGTGCGACTGCACTACGGCATCCCTGCCATTGTGAAACTTCTCAACCCACCATACCAGTGGCCACTGGTCAAGGCAACCATCGGCTTGATCCGGAACCTGGCCCTTTGTCCAGCCAATCATGCTCCCTTATACGATGCAGGTGTCATTCCCAGGCTAGTCCAGCTGCTGGTTAAAGCTCACCAAGATGCACAGAGGCATGCAGCTTCCGGGGCACAGCAACCCTACACGGATGGAGTGAAGATGGAAGAGATTGTGGAAGGTTGCACTGGGGCTCTGCATATTCTTGCCAGGGATCCTGTGAACCGTATGGACATCTACAAGCTAAACACCATCCCGCTGTTTGTACAGCTCCTGTATTCCCCTGTGGAGAACATTCAGAGAGTGGCCGCGGGCGTGCTGTGTGAGTTGGCTCAGGATAAAGAAGCGGCAGACACCATTGATGCAGAGGGAGCCTCAGCCCCACTCATGGAATTGCTGCACTCCCGCAATGAAGGCATAGCCACATATGCTGCTGCTGTTCTATTCCGCATATCCGAGGACAAAAACGCAGATTATAGGAAGCGCGTGTCCGTGGAGCTCACTAATGCCATCTTCCGACAGGATCCTGCCGCCTGGGAAGCAGCGCAGAGCATGATTCCTCTTAATGATCCTTATCCAGATGAAATGGAAAATTATCGAGCTATGTACCCTGAAGATATTCCATTAGAACCAATGGGAGGAGATATGGATGTGGAGTATGCAATGGATGGCTACAGTGACCACCCAGTCAGGGGGGGCTACTCTGATAACCACATGATGGCATAA
Full Trace Sequence: ctgaattgtggggatacagaggcctcttccagcgcttcacaacgcaggaagtagaatggatttggtggatgtagtggaagtgccaataaaagtcacagagtggcagaaaacctacacttacgactcgggcatcaattctggaataaacacagcgtctccatcgttaaacgggaaaatggtcatcgaggacgacagccatgcctaccccggcagttacactgttaaaaccacgacgtacacacagcagcagaccccagacatggacgcccagataaacatgactcgagcccagcgcgtccgagcagcaatgtacccagagacggtggaagatcactcgtaccttctgactacccagatagaagggcagcaaaccaacgtgcagaaactggcggaaccctcccaaatgttgaaatctgctatcatccaccttatcaactaccaggatgatgctgagcttgccacccgcgccattccggaactgacaaagctacttaatgatgaggatccgatggtggtgaacaaggcttccatgattgtaaaccagctgtccaagaaagaggcatcccgcaaagccctgatgcagtccccgcagattgttgccgctgtagttcgcaccatgcagcacacaagtgacatggacaccgctcgctgtaccaccagcatcctgcacaacctgtcccatcaccgcgaggggcttctgtctatcttcaaatccggcggcatccctgcacttgtgcgcatgctcagttctccagtagaatccgtgttattctatgccatcaccaccttgcacaacctgctgctctaccaggaaggggcaaagatggcagtgcgtctggcagatggtctccagaagatggtgcctttgcttaataagaataaccccaaattcttggccatcactacagactgccttcagctcttggcctatggaaatcaggagagcaagctaattatattggccaatggaggacctcaagggttggttcagatcatgaggaactacaattacgagaagcttctgtggaccacaagccgggtgctaaaagtattgtctgtgtgtcccagcaataaaccagccattgtggaagccggtggaatgcaagcactggggaaacatctgaccagcaacagcccaagacttgtacagaactgcctgtggacattaaggaatctctctgatgtggccactaaacaggagggcctggataacgttctaaagatcctggtgaaccagctgagttctgatgatgtaaacgtcctcacctgtgccactggcacattgtccaacctcacctgcaacaacggtcgcaacaagactctcgtgacgcagagcaacggggttgagtctctgattcacaccatccttcgtgcgagtgacaaggatgacattgcagagcctgctgtctgtgccctgcgtcacctgaccagtcgccaccaagacgcagaggtggctcagaattcagtgcgactgcactacggcatccctgccattgtgaaacttctcaacccaccataccagtggccactggtcaaggcaaccatcggcttgatccggaacctggccctttgtccagccaatcatgctcccttatacgatgcaggtgtcattcccaggctagtccagctgctggttaaagctcaccaagatgcacagaggcatgcagcttccggggcacagcaaccctacacggatggagtgaagatggaagagattgtggaaggttgcactggggctctgcatattcttgccagggatcctgtgaaccgtatggacatctacaagctaaacaccatcccgctgtttgtacagctcctgtattcccctgtggagaacattcagagagtggccgcgggcgtgctgtgtgagttggctcaggataaagaagcggcagacaccattgatgcagagggagcctcagccccactcatggaattgctgcactcccgcaatgaaggcatagccacatatgctgctgctgttctattccgcatatccgaggacaaaaacgcagattataggaagcgcgtgtccgtggagctcactaatgccatcttccgacaggatcctgccgcctgggaagcagcgcagagcatgattcctcttaatgatccttatccagatgaaatggaaaattatcgagctatgtaccctgaagatattccattagaaccaatgggaggagatatggatgtggagtatgcaatggatggctacagtgaccacccagtcagggggggctactctgataaccacatgatggcataaatcctcttgcacaagacatctactacagaagaatcttttcaagacaaaaagtgcctacagtggatctgctccttcttcccctttacaggcccctatattccctttttaaagagcttttatttgatagaatttgcttggggtgggattttgtaaatgcccctcagcaccaggggtctggcttttagtttgctaaatattaacctccccaactcagcacctttttgaggttaatagattttttttttttatgtagatcgccgcatccaaaagcttgtgttgctctactgccttctttttctatagattataaatatatatttttctttttttttttttttttaaatatggtgcaaagagtgcttgtcctttttacatgccacagttttattttgtaatttgttttatctcccaacctctgcaattctgtagccgtcaatactaaaagaagccattgcatacagacacacacgtttactgttggcctttcagtggttgggcgttctttactggctggtgaccggcagactgatttctattggattgtaatcattttgtgacaaaaaaaaaagaaaataaaaatctgtatattctgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDLVDVVEVPIKVTEWQKTYTYDSGINSGINTASPSLNGKMVIEDDSHAYPGSYTVKTTTYTQQQTPDMDAQINMTRAQRVRAAMYPETVEDHSYLLTTQIEGQQTNVQKLAEPSQMLKSAIIHLINYQDDAELATRAIPELTKLLNDEDPMVVNKASMIVNQLSKKEASRKALMQSPQIVAAVVRTMQHTSDMDTARCTTSILHNLSHHREGLLSIFKSGGIPALVRMLSSPVESVLFYAITTLHNLLLYQEGAKMAVRLADGLQKMVPLLNKNNPKFLAITTDCLQLLAYGNQESKLIILANGGPQGLVQIMRNYNYEKLLWTTSRVLKVLSVCPSNKPAIVEAGGMQALGKHLTSNSPRLVQNCLWTLRNLSDVATKQEGLDNVLKILVNQLSSDDVNVLTCATGTLSNLTCNNGRNKTLVTQSNGVESLIHTILRASDKDDIAEPAVCALRHLTSRHQDAEVAQNSVRLHYGIPAIVKLLNPPYQWPLVKATIGLIRNLALCPANHAPLYDAGVIPRLVQLLVKAHQDAQRHAASGAQQPYTDGVKMEEIVEGCTGALHILARDPVNRMDIYKLNTIPLFVQLLYSPVENIQRVAAGVLCELAQDKEAADTIDAEGASAPLMELLHSRNEGIATYAAAVLFRISEDKNADYRKRVSVELTNAIFRQDPAAWEAAQSMIPLNDPYPDEMENYRAMYPEDIPLEPMGGDMDVEYAMDGYSDHPVRGGYSDNHMMA
Donor tissue: neurula