ORFeome > kmo – XORFeome 2.0

kmo – XORFeome 2.0

General Information

Species: Xenopus tropicalis kynurenine 3-monooxygenase (kynurenine 3-hydroxylase), mRNA (cDNA clone MGC:89113 IMAGE:7006634), complete cds
Gene Symbol: kmo
Gene ID: 448312
ORF gb_acc: MG134189
ORF ID: 11834

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075387

Library Location

Plate ID: GDExt11017
Well Location: D11

EST Sequences

Clone: MGC:89113 IMAGE:7006634
Trimmed Sequence: ATGGAAATACAAGGGAATCGGAAGAAAACTGTATCTGTTGTAGGAGGGGGTTTGGTTGGAAGCCTTAATGCATGTTTCTTTGCTAAGAAAGGATTCCAAGTGGAGCTCTATGAAGCAAGGGAAGATATTCGCTATGCCAGAATGGTTAGTGGAAGAAGCATCAACTTGGCACTTTCACACAGAGGACTTCAAGCTCTCAAGGCTGTTGGTTTGGACGAAAAGATTGCAGCAATGGGCATCCCAATGCGTGCAAGAATGATTCATTCTGTAAAAGGAAGAAAATCTAGCATCCCCTATGGAAAGCAACACCAGTATATCCTATCTGTTGACAGAGCTAATTTAAATAAAGAACTGTTAAGTGCTGCAGAAAAGTACTCTAATGTCACAATGCACTTTGAACACAAGTTACGCGACTGCAATGTTGACTCTGGCACAATGACATTTCTTAACAACATGGAAAATATCATTGAAAAAAAAGCTGATTTAATTGTAGGATGTGATGGAGCCTTCTCTGTTGTACGCAAACAATTTATGAGGAAGTCACGTTTCAATTACAGTCATGTATACATACCTCATGGTTATAAAGAACTAACTATTCCGCCAAGAAAAGGAGAGTTTGCCATGGAGCCAAACTACCTCCATATTTGGCCAAGAAACACATTTATGATGATTGCACTTCCTAATCTGGACAAATCTTTTACATGCACACTTTTCATGCCATTTGAAGATTTTGAAAAACTCACTACAGGTGACCAAGTTCTGGATTTCTTCAAGACATACTTTCCAGACTCCATTGAACTAATTGGAGAAAAGAAATTAACAGAAGACTTCTTTCTGCTGCCACCACAAGCAATGATTTCTGTAAAGTGTTCTTCATTTTGTATTGACCATAAATGTGTTATCATGGGAGATGCAGCACATGCAGTTGTACCCTTCTATGGGCAAGGAATGAATGCAGGCTTTGAAGACTGCCTTGTTTTTTCAGAACTAATGGAGCAATACCAAAACAATTTAAGAATCTGCCTGCATGAGTTCTCCAGGCTACGAGTACCAGATGCGCACGCAATATCGGACTTGGCTATGTATAACTACAAAGAAATGCGCGCTCATGTCAATTCTAAGTGGTTCATCTTTCGGAAACAGGTTGACAACATTCTGAATGCCATCATGCCTACAACATTTATTCCACTGTATACAATGGTAACATTCAGCAGAATAAGATACCATGAAGTTATACTGCGCTGGAAGTGGCAAAAAAAGATCATAAATGTGGGACTTTTTACTGTTGGTACAACTGGATCTGTTGGTGCTGCGTATTTGGTTATAAAATACTTGCCTTTTAATAAATACATTGAACATGTAGGTAATTGTTTAACGCATCTGAAAGGGAATGCATACCTATCAAGACTGTGGGCAAAATGA
Full Trace Sequence: cagctcttagcatttaatctgttactctgagatccagaaaaggggaaaacattagcagcctccaaaatggaaatacaagggaatcggaagaaaactgtatctgttgtaggagggggtttggttggaagccttaatgcatgtttctttgctaagaaaggattccaagtggagctctatgaagcaagggaagatattcgctatgccagaatggttagtggaagaagcatcaacttggcactttcacacagaggacttcaagctctcaaggctgttggtttggacgaaaagattgcagcaatgggcatcccaatgcgtgcaagaatgattcattctgtaaaaggaagaaaatctagcatcccctatggaaagcaacaccagtatatcctatctgttgacagagctaatttaaataaagaactgttaagtgctgcagaaaagtactctaatgtcacaatgcactttgaacacaagttacgcgactgcaatgttgactctggcacaatgacatttcttaacaacatggaaaatatcattgaaaaaaaagctgatttaattgtaggatgtgatggagccttctctgttgtacgcaaacaatttatgaggaagtcacgtttcaattacagtcatgtatacatacctcatggttataaagaactaactattccgccaagaaaaggagagtttgccatggagccaaactacctccatatttggccaagaaacacatttatgatgattgcacttcctaatctggacaaatcttttacatgcacacttttcatgccatttgaagattttgaaaaactcactacaggtgaccaagttctggatttcttcaagacatactttccagactccattgaactaattggagaaaagaaattaacagaagacttctttctgctgccaccacaagcaatgatttctgtaaagtgttcttcattttgtattgaccataaatgtgttatcatgggagatgcagcacatgcagttgtacccttctatgggcaaggaatgaatgcaggctttgaagactgccttgttttttcagaactaatggagcaataccaaaacaatttaagaatctgcctgcatgagttctccaggctacgagtaccagatgcgcacgcaatatcggacttggctatgtataactacaaagaaatgcgcgctcatgtcaattctaagtggttcatctttcggaaacaggttgacaacattctgaatgccatcatgcctacaacatttattccactgtatacaatggtaacattcagcagaataagataccatgaagttatactgcgctggaagtggcaaaaaaagatcataaatgtgggactttttactgttggtacaactggatctgttggtgctgcgtatttggttataaaatacttgccttttaataaatacattgaacatgtaggtaattgtttaacgcatctgaaagggaatgcatacctatcaagactgtgggcaaaatgaagaaaaaaggcaaagaattgtgaactgttacaagctgtggccatatttgtttgtaatataaactatattgaatacatttaagtacttaacttttacacttacactttccttttcttctggccataataaacatttaattaaaatgttcttcttaatttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEIQGNRKKTVSVVGGGLVGSLNACFFAKKGFQVELYEAREDIRYARMVSGRSINLALSHRGLQALKAVGLDEKIAAMGIPMRARMIHSVKGRKSSIPYGKQHQYILSVDRANLNKELLSAAEKYSNVTMHFEHKLRDCNVDSGTMTFLNNMENIIEKKADLIVGCDGAFSVVRKQFMRKSRFNYSHVYIPHGYKELTIPPRKGEFAMEPNYLHIWPRNTFMMIALPNLDKSFTCTLFMPFEDFEKLTTGDQVLDFFKTYFPDSIELIGEKKLTEDFFLLPPQAMISVKCSSFCIDHKCVIMGDAAHAVVPFYGQGMNAGFEDCLVFSELMEQYQNNLRICLHEFSRLRVPDAHAISDLAMYNYKEMRAHVNSKWFIFRKQVDNILNAIMPTTFIPLYTMVTFSRIRYHEVILRWKWQKKIINVGLFTVGTTGSVGAAYLVIKYLPFNKYIEHVGNCLTHLKGNAYLSRLWAK
Donor tissue: