ORFeome > LOC394934 – XORFeome 2.0

LOC394934 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein LOC394934, mRNA (cDNA clone MGC:76238 IMAGE:5336684), complete cds
Gene Symbol: LOC394934
Gene ID: 394934
ORF gb_acc: MG134281
ORF ID: 11950

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064245

Library Location

Plate ID: GDExt11019
Well Location: D06

EST Sequences

Clone: MGC:76238 IMAGE:5336684
Trimmed Sequence: ATGAGTGGCTTAAACTTTGGTGCTGCCTCTGCTGGAGGATTTAGCTTTGGGACACCAAAAACCAATACTACAACTGCTACAACTGGCTTTTCCTTTGGTGCAACAACTGCAGCCCCTTCTGGTGGTTTCAATTTCGGCACAGCCACACAGACTCCTGCTTCCACCACAGGCCAAGCAACTGGACTTTTTTCTTTCTCCACTCCAGCCTCTTCTGCAGCACCAACATCTGGGTTCAGCTTTGGTGCACAAGTAACATCTACTCCAGCACCTGCCTCAGGTGGTCTTACCTTTGGTGCAAACACGCCCAAACTGAATTTAGGATTAGGAAATCAGCCTGCTGCTGCCACCGCTCAAACATCCCAACCCTTGGGAGGTTTCTCATTTGGAAATGCACCAGTACAGACACAACCATCTACCACCAGTGTTGGGGGCTTCGCATTTGCTGGTGGAGTTGGTTCTACAGCTACAAATGCCTTTGCACAACCTGCAGCTCCCACGGGCATCACCTTTGCAGCAGCAGTTTCAACAGCTGCAGCACCAATAACCACATCTCAGCCTGCCAGTACCTTTAGCTTTGGAACCCAGCCACAAGCAGCCCCTGGTTTGAACTTTGGTTTATTGTCATCGACTCAGTCTGCTGTTCCTTCCACTGCTTCTACTCCAGCTGCCTCGCAGTCGGTAGCACCAACACCTGGGCTTAGCCTTACATCATTGGGCAAACCAGCAGACCCATCTGCAGCAATGGTATCCACAGGAACCGCCACAACAGCCACACCTTCCCTTTCTTCCCTTCTGGGGACATCTGGGCCCTCTCTCTTCTCTTCTTTGGCTACTTCAACTGCTGCAGCTGTTGTGACGACAACAACAACAGCAGCAGCAAGTGGACTGTCATTGAGTTCGACTACAGCAGGCACGGGTTTTGGAATGAAGATTTTGCCAAGCAGTGCTGCACCAACAGGAACATTGCCTACCAGCACCTCTCTTGGTATGAGAACTCCACTTTCTGGAACCACAGTTCAGGCTAATGTTGTCAGTTCTGCTGCAGCTGCAGGAGTCGGTACTGCTGCAACAATGACTTATGCTCAGCTAGAAAATCTGATTAATAAGTGGAGTTTGGAATTGGAAGATCAAGAAAAACACTTTCTGCAACAAGCAACTCAGGTCAACGCATGGGACAGAACTCTTATGCAGAATGGAGAACGGATCACCACTTTACACAGAGAAATGGAAAAAGTTAAACTGGACCAGAAAAGGTTGGATCAGGAACTGGACTTCATCTTGTCACAGCAAAAAGAACTGGAGGACCTTCTGACTCCTCTGGAGGAATCTGTGAAAGAGCAGAGCGGAACCATTTACCTCCAGCATGCAGATGAAGAGAGAGAGAAAACGTACAAGCTGGCAGAAAACATTGATGCCCAGCTGAAGCGCATGGCCCAGGATCTAAAGGAGGTTATAGAGCATCTGAACACATCAGCTGGGCCAGGGGATGCTGGAAACCCGCTCCAGCAGATATGCAAGATTCTCAATGCCCACATGGACTCTTTACAGTGGATTGATCAGAACAGTGCTCTTCTTCAGAGGAAGGTTGAGCAGGTAACAAAAGAGTGTGAAAGCCGAAGGAAGGAACAGGAGCGTGGATTTTCCATAGCATTTGATTAA
Full Trace Sequence: aaagaattgaccactatgagtggcttaaactttggtgctgcctctgctggaggatttagctttgggacaccaaaaaccaatactacaactgctacaactggcttttcctttggtgcaacaactgcagccccttctggtggtttcaatttcggcacagccacacagactcctgcttccaccacaggccaagcaactggacttttttctttctccactccagcctcttctgcagcaccaacatctgggttcagctttggtgcacaagtaacatctactccagcacctgcctcaggtggtcttacctttggtgcaaacacgcccaaactgaatttaggattaggaaatcagcctgctgctgccaccgctcaaacatcccaacccttgggaggtttctcatttggaaatgcaccagtacagacacaaccatctaccaccagtgttgggggcttcgcatttgctggtggagttggttctacagctacaaatgcctttgcacaacctgcagctcccacgggcatcacctttgcagcagcagtttcaacagctgcagcaccaataaccacatctcagcctgccagtacctttagctttggaacccagccacaagcagcccctggtttgaactttggtttattgtcatcgactcagtctgctgttccttccactgcttctactccagctgcctcgcagtcggtagcaccaacacctgggcttagccttacatcattgggcaaaccagcagacccatctgcagcaatggtatccacaggaaccgccacaacagccacaccttccctttcttcccttctggggacatctgggccctctctcttctcttctttggctacttcaactgctgcagctgttgtgacgacaacaacaacagcagcagcaagtggactgtcattgagttcgactacagcaggcacgggttttggaatgaagattttgccaagcagtgctgcaccaacaggaacattgcctaccagcacctctcttggtatgagaactccactttctggaaccacagttcaggctaatgttgtcagttctgctgcagctgcaggagtcggtactgctgcaacaatgacttatgctcagctagaaaatctgattaataagtggagtttggaattggaagatcaagaaaaacactttctgcaacaagcaactcaggtcaacgcatgggacagaactcttatgcagaatggagaacggatcaccactttacacagagaaatggaaaaagttaaactggaccagaaaaggttggatcaggaactggacttcatcttgtcacagcaaaaagaactggaggaccttctgactcctctggaggaatctgtgaaagagcagagcggaaccatttacctccagcatgcagatgaagagagagagaaaacgtacaagctggcagaaaacattgatgcccagctgaagcgcatggcccaggatctaaaggaggttatagagcatctgaacacatcagctgggccaggggatgctggaaacccgctccagcagatatgcaagattctcaatgcccacatggactctttacagtggattgatcagaacagtgctcttcttcagaggaaggttgagcaggtaacaaaagagtgtgaaagccgaaggaaggaacaggagcgtggattttccatagcatttgattaaagcaaatggatgttccatacaaattgagaattctgttttgttgacttttttttgtattctacccatcttcgattcattgtttaaataaaatataatttttgttgttttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSGLNFGAASAGGFSFGTPKTNTTTATTGFSFGATTAAPSGGFNFGTATQTPASTTGQATGLFSFSTPASSAAPTSGFSFGAQVTSTPAPASGGLTFGANTPKLNLGLGNQPAAATAQTSQPLGGFSFGNAPVQTQPSTTSVGGFAFAGGVGSTATNAFAQPAAPTGITFAAAVSTAAAPITTSQPASTFSFGTQPQAAPGLNFGLLSSTQSAVPSTASTPAASQSVAPTPGLSLTSLGKPADPSAAMVSTGTATTATPSLSSLLGTSGPSLFSSLATSTAAAVVTTTTTAAASGLSLSSTTAGTGFGMKILPSSAAPTGTLPTSTSLGMRTPLSGTTVQANVVSSAAAAGVGTAATMTYAQLENLINKWSLELEDQEKHFLQQATQVNAWDRTLMQNGERITTLHREMEKVKLDQKRLDQELDFILSQQKELEDLLTPLEESVKEQSGTIYLQHADEEREKTYKLAENIDAQLKRMAQDLKEVIEHLNTSAGPGDAGNPLQQICKILNAHMDSLQWIDQNSALLQRKVEQVTKECESRRKEQERGFSIAFD
Donor tissue: tailbud