ORFeome > LOC496579 – XORFeome 2.0

LOC496579 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical LOC496579, mRNA (cDNA clone MGC:79682 IMAGE:6980722), complete cds
Gene Symbol: LOC496579
Gene ID: 496579
ORF gb_acc: MG134286
ORF ID: 11958

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084917

Library Location

Plate ID: GDExt11019
Well Location: F02

EST Sequences

Clone: MGC:79682 IMAGE:6980722
Trimmed Sequence: ATGGAGAATAAGAAAGAAACGGACAGCCAGCCCTTGAGTGATGGAACTTCTAGGAAAGAGTCAGAAAATGTATGTTTAAAGCGCGAGTTGGGGCTGCCCAGTGCTGTGTCACTGATCGCTGGCACCATGATTGGCTCAGGAATCTTCATGTCTCCCCAGTGGGTCCTTTACCATATGGGAAGCCCAGGGGCCAGTCTGTTGATCTGGGCTTCATGTGGATTGCTGGCCATGTTGGGGGCATTATCCTATGCTGAGTTGGGAACGGTCATTAAAGAGTCTGGAGGGGAATACATTTATATTTTACGGAACAGTGGACCTCTGCTGGCTTTTCTCCTTGCCTACACCTCTGTCATTGTGGTAAGACCAGCTGGTATTGCCGGAATCTCCCTAAGCTTTGCAGAGTACGTTGTGGCTTCTTTTTATCCAGACTGCCCGTCGCCAACTGTGGCTGTCAAATTCACGGCTGCTGCATGTATCCTAGTCTTGGGCATCATCAACTGTCTCAATGTCAAGCTGTCCACCTCCATTATGAACATATTCACCACTGCCAAACTGTTGGTGTTGCTTCTTATAATAGTGGGGGGCATGGTATTACTGGCCAAGGGCCACACTCAGGGCCTGCAGAATGCCTTTGACAACACAGCTACAGGTTTTGGCCCTGTAGGAGTGGCTTTTTACCAAGGACTCTGGTCTTATGATGGTTGGAACAACCTGAACTATGTCACAGAGGAGCTGAAGAAACCTGAGGTTAATCTCCCCCGAGCTGTAATGATTGCCATCCCGCTGGTCACCTGTGTGTACCTGCTGGTCAACGTCAGCTATTTTGTAGCTATGACGCCCAGAGAACTTCTCTCTTCAGACGCTGTCGCTATCAGCTGGGGGGTGAAGCTGCTCGGCACTTGGACATGGATTATATCCCTGGGTGTCGCCCTCTCTACGTTCGGCTCTGCCAATGGAACCTTCTTTACTGGGGGCCGTTTGTGCTACGTGGCAGCGAGAGAAGGGCATTTGCCAGACATCTTGTCGATGGCCAACGTGAAACGCCTCACGCCTTCCCCCGCCCTTATATTCACCACCGCCATCTCTTTAATCATGATCATACCTTCAGACTTCAGCAGTATTGTGAATTTTTTCAGTTTCACGGCCTGGCTGTTCTACGGTATAACCATAGCTGGGCTCCTGTACATGAAGATCAAGAAACCGGACCTTCCGCGGCCATATAAGGTTCCCATTGTGATCCCGATCATTGTGCAGATTGCATCAGTGTACCTGGTGCTGGCGCCCATCATTGGAAGCCCCCAGCTGGAATACCTGTATGTAGTGCTCTTTATTCTCAGTGGGCTCATTGTCTACATTCCCGTGGTCCATTACAAGTGGTCTCCCAAATGTTTCCGATCAGTTACTCTCCAGCTCCAGCTTCTGCTTCAGGTTGCACCGACAAATAAAAATGACTGA
Full Trace Sequence: agacagatacaatcctctgaggcttcacgatggagaataagaaagaaacggacagccagcccttgagtgatggaacttctaggaaagagtcagaaaatgtatgtttaaagcgcgagttggggctgcccagtgctgtgtcactgatcgctggcaccatgattggctcaggaatcttcatgtctccccagtgggtcctttaccatatgggaagcccaggggccagtctgttgatctgggcttcatgtggattgctggccatgttgggggcattatcctatgctgagttgggaacggtcattaaagagtctggaggggaatacatttatattttacggaacagtggacctctgctggcttttctccttgcctacacctctgtcattgtggtaagaccagctggtattgccggaatctccctaagctttgcagagtacgttgtggcttctttttatccagactgcccgtcgccaactgtggctgtcaaattcacggctgctgcatgtatcctagtcttgggcatcatcaactgtctcaatgtcaagctgtccacctccattatgaacatattcaccactgccaaactgttggtgttgcttcttataatagtggggggcatggtattactggccaagggccacactcagggcctgcagaatgcctttgacaacacagctacaggttttggccctgtaggagtggctttttaccaaggactctggtcttatgatggttggaacaacctgaactatgtcacagaggagctgaagaaacctgaggttaatctcccccgagctgtaatgattgccatcccgctggtcacctgtgtgtacctgctggtcaacgtcagctattttgtagctatgacgcccagagaacttctctcttcagacgctgtcgctatcagctggggggtgaagctgctcggcacttggacatggattatatccctgggtgtcgccctctctacgttcggctctgccaatggaaccttctttactgggggccgtttgtgctacgtggcagcgagagaagggcatttgccagacatcttgtcgatggccaacgtgaaacgcctcacgccttcccccgcccttatattcaccaccgccatctctttaatcatgatcataccttcagacttcagcagtattgtgaattttttcagtttcacggcctggctgttctacggtataaccatagctgggctcctgtacatgaagatcaagaaaccggaccttccgcggccatataaggttcccattgtgatcccgatcattgtgcagattgcatcagtgtacctggtgctggcgcccatcattggaagcccccagctggaatacctgtatgtagtgctctttattctcagtgggctcattgtctacattcccgtggtccattacaagtggtctcccaaatgtttccgatcagttactctccagctccagcttctgcttcaggttgcaccgacaaataaaaatgactgagctgatgccatggaccatgactcctggtgtcagagggatgtttgtaccagtggcatctcttccatgtaacgaaaatgaaattgtgcccctcttgagaagggaagtggcattgtctgaaagcagacagatttcatgaaaatatcatcattgatcccatggagttatatatatattgctcaatgccaggctggggccccaccagtgaaaccgatgccaatgctccacggccggagagaagaaataagctgaatttatgaaacacacaaaggcttgctttatgtggcttcctattggctgcctggctcgcactggaggttgagactgacagatccaattgcactgatgctgacactcagaaccaatgagcagggaccctcagcatggacgcccaatttagaatgggagcagtgagcatgaaaatgaaatgtaacttttaattgcagagtatgttttaaaaatatatattatacattaggcaaaaaaaaaatctggagcaaaatttggaagaaatttatactgatcagttgcagattttgatagcaaaaaagttatatttttaagtgaaactgttgtgctcccttatctatgagcagaccctgattggcaatctggatatcctggcaaaagccacagaccaacattcctagtttggccagtttggccattggggtgcccaagtgcacaatgaatatcagcccgagtcatgcaacccttctaccagtccttgtgttaattagccactaggaggcactgtttcattacagtctatggataccatctattcaacctgcccccccaagcaaacaataacctgattggccaaagagctggatgatcttcactggtccttggatagtcagatctcaccgctttctcctttttcttttttttccatttcatttacgttagttgtaaaaaaaaagatatttattgccacatttatattgccatatacagcagactggccaaaaggagtgtgcaggggtctgtattgttacttcctggaatggaggggcatgaacctattgtagctgaccaggcgccagtttggtgaagggcacatggggagcaaaagggtgccagcttaatatgtagccatggccactaacagcagctcgctgactaaatacattggcttgtgtcattctgtctggctgccacccagagggaacagcagggggcgctccagtaacaaatgaaattagcacaactattcttctattacattctatacagtagggtaaaaaaaatctagataatcagaataacagatgtagctctgtgcattgggggaaagttcttctcagatacatattgggtatctataaaaccatttagaatcccataaagaaccagtcttcatctattctattctgctataggaccagggtcaaaatattattcctcttcattggccagtacaggaggcacttggctgaacctggtcaatgtgaatctatatatatataatataggaggatataccagtgtgtgccccataatcagtcttttaccttacaagtacaacataccaggagggtggggggtacaccaccttggcactgaaggttccacaagtcctgctgacccggtggagcccaggtgactggaaaccctttccaagttgccatattgctttgtctttgggcttataaaaattctttactctaggacccagatgcttctagttacatggcggatagagtatataaatcagtctattgccagaccattactcaaaccgacagttagtatgaagccctgtgatgggcacgctgggatattaatgcatttcttgttaaggaacaacgggttattgggcttccatagcctctgaggagcagaaccagcgctttcagggtcggaggactcagcctactcctctgtttgaagtcctgtagaggatccttttctctctgcccggccattcatgttattagctgctcccaaggagccggctttccggctaaacaagagaaattgtatcctacttatcatctcttcccacctgctgtcccaagtggccctgcaaaaaactgacccagtctttcaagagatgaaacagggtgctttagccagacataaaggagctttgtcctgatgtggcccctgtgccatatttttccctgctcccatgtttcccctgggtcaggcacagactgggattcacaattggccctggtatttcaagtagacagagccccccccagcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagaacccagagattgccagtctgggccttccctgggccaatacctgtgccatacagtaatctccaaaaaagctctgtactgtgcacctctgtgcacaagggatgcctgggagcaagggagaagatggtggggtatactccataggaaagaaaccccatgacgtatgctgggggtggggggggatctattaaattaccttgtgaatcccattggggacatgtcagtgtaatgtgcctgatcagcatatgtcaatcaatgtcacatgacaagaacagcccaattctaagaagggacggtgatgtaatttatagcaaattcacaataaaagtgggcaaggtgcaggttaaaggggccatacactatatctgaccaatcatggatgatatacacgtattccattgtaataatccaattaaaattgcggaaagtgaaaaaaaaaaaaaaaaaaaaaa
Translation: MENKKETDSQPLSDGTSRKESENVCLKRELGLPSAVSLIAGTMIGSGIFMSPQWVLYHMGSPGASLLIWASCGLLAMLGALSYAELGTVIKESGGEYIYILRNSGPLLAFLLAYTSVIVVRPAGIAGISLSFAEYVVASFYPDCPSPTVAVKFTAAACILVLGIINCLNVKLSTSIMNIFTTAKLLVLLLIIVGGMVLLAKGHTQGLQNAFDNTATGFGPVGVAFYQGLWSYDGWNNLNYVTEELKKPEVNLPRAVMIAIPLVTCVYLLVNVSYFVAMTPRELLSSDAVAISWGVKLLGTWTWIISLGVALSTFGSANGTFFTGGRLCYVAAREGHLPDILSMANVKRLTPSPALIFTTAISLIMIIPSDFSSIVNFFSFTAWLFYGITIAGLLYMKIKKPDLPRPYKVPIVIPIIVQIASVYLVLAPIIGSPQLEYLYVVLFILSGLIVYIPVVHYKWSPKCFRSVTLQLQLLLQVAPTNKND
Donor tissue: tailbud