ORFeome > LOC496709 – XORFeome 2.0

LOC496709 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical LOC496709, mRNA (cDNA clone MGC:106023 IMAGE:6977335), complete cds
Gene Symbol: LOC496709
Gene ID: 496709
ORF gb_acc: MG134446
ORF ID: 12147

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC087863

Library Location

Plate ID: GDExt11020
Well Location: C11

EST Sequences

Clone: MGC:106023 IMAGE:6977335
Trimmed Sequence: ATGGCGACGTCCTGTGAAGATGTTTCGCCTGTAAAATCTCCTGCTGTGACTCCTTTGAAGATTCGGGAACTCATTAACGAGGGAATCGTGACGGGGGAAAGAAGCAGTATCGGGAGAAAGGAAACTGCTGTAGTACCAGAAGAGAATAATGGATTTGAAGATCCACTAAGCAACAGCTCCTATGAAAGTACCAGTAAAGATGCCTTCTTTGGCAGAGTGGAATCATTCTCCTCCTTGAAGTGGGCTGGTAAGCCGTCTGAATTGTGTCCTCTAATTTGTGCCAAGTATGGATGGTCCAATATAGAATGCGATATGTTAAAGTGTTCAAGTTGTAATGCATACCTCTGTGCCAGCCTCCAGCCAGTACTGGATTTCAGCAAGTATAAGCAGCGTTGTGTGGAGCTGCAGGAGGCCTTGAGAAAAGCACATGAGAAGTTCTGTTTTTGGCCAGACAGCCCATGCCCAGATTATTTCTGGGCTCTTATGGTTACAGAGCCATCCTCTGTATTAAGTGATTTTGTGGGGCGTTTTGACAACCTCTGTCATCTAGAGATTCAGCTGCCTTCAATAAAACATGAAGATTTAAAAAACATGGATATCACAGAAGAAACCGTGAGTCATCTCTTAAGGCTGATTGAAGATGAACTTAAATCTAAGGATGGAAGGGAGGATAATTCTCGCCTGGCATCAGACTCTCTGCAGGTTCATATCTCAGCCTGTATTTTAGCACTGTGTGGGTGGAGCACCAGCTATACATCTGGGTCTTTGTGTATCATTAATTGCCCTCGCTGCATGCGAAAGGTTGGGCTTTGGGCCTTCCAGCAGTTAGAAGCTGTAGAGCTGGACAACTCATTGAGTGCACCGAACACACCTGTTTCTCCAGCTGAGGGGCATGAAAGAAGCCCGTTTGGTATTATGTCACCAAACAGGAGAGTTACACGTAGCCGTGATGCTGAGCAGAGCCCTGCTTTGGCTTATGGTAGGACAAGAAGCTCTGACCTCTTAAGCCCAGCAGATTCAGAAGCTGTACGCAGTCGTCCTGTGACACGCAGCATGGGCCAGGGTGAAAGCTCAGGGCTTAGCAATGAGTTACACTCCAGCCCACTGCGTAGGTCAAAACGTCCTCGACTCTGCTCCAGCAGTAGCTCTGACACCTCTCCTAGGGGCTGCTTTGATCCACTGTCTCAGCACAGGAGTTGGTGCCCTTGGGTTAATGTGTGCCAGGCAAGTGAAACAAGCACATTAGGATCAGAAATCCAAGAGGAAGCCAGCAGAAAGGAGTATGGCTGGAAGGAGGTGTTAAATGTGCTCCTGGCTGAGGAGAATTCCAGAACCTTATCTGACCCTGATACCTCTAGTGTTCCAGAAAAATCCCACAAGGTCTTCAGGATCTTCCGGCAGTGGCAGATGGCAGCTTCAGCTTCAGAAAACCCATAA
Full Trace Sequence: ggggctaaggaaatggcgacgtcctgtgaagatgtttcgcctgtaaaatctcctgctgtgactcctttgaagattcgggaactcattaacgagggaatcgtgacgggggaaagaagcagtatcgggagaaaggaaactgctgtagtaccagaagagaataatggatttgaagatccactaagcaacagctcctatgaaagtaccagtaaagatgccttctttggcagagtggaatcattctcctccttgaagtgggctggtaagccgtctgaattgtgtcctctaatttgtgccaagtatggatggtccaatatagaatgcgatatgttaaagtgttcaagttgtaatgcatacctctgtgccagcctccagccagtactggatttcagcaagtataagcagcgttgtgtggagctgcaggaggccttgagaaaagcacatgagaagttctgtttttggccagacagcccatgcccagattatttctgggctcttatggttacagagccatcctctgtattaagtgattttgtggggcgttttgacaacctctgtcatctagagattcagctgccttcaataaaacatgaagatttaaaaaacatggatatcacagaagaaaccgtgagtcatctcttaaggctgattgaagatgaacttaaatctaaggatggaagggaggataattctcgcctggcatcagactctctgcaggttcatatctcagcctgtattttagcactgtgtgggtggagcaccagctatacatctgggtctttgtgtatcattaattgccctcgctgcatgcgaaaggttgggctttgggccttccagcagttagaagctgtagagctggacaactcattgagtgcaccgaacacacctgtttctccagctgaggggcatgaaagaagcccgtttggtattatgtcaccaaacaggagagttacacgtagccgtgatgctgagcagagccctgctttggcttatggtaggacaagaagctctgacctcttaagcccagcagattcagaagctgtacgcagtcgtcctgtgacacgcagcatgggccagggtgaaagctcagggcttagcaatgagttacactccagcccactgcgtaggtcaaaacgtcctcgactctgctccagcagtagctctgacacctctcctaggggctgctttgatccactgtctcagcacaggagttggtgcccttgggttaatgtgtgccaggcaagtgaaacaagcacattaggatcagaaatccaagaggaagccagcagaaaggagtatggctggaaggaggtgttaaatgtgctcctggctgaggagaattccagaaccttatctgaccctgatacctctagtgttccagaaaaatcccacaaggtcttcaggatcttccggcagtggcagatggcagcttcagcttcagaaaacccataaatgccccttttatttctaacacagtgggaccttttggcattccagactatgaaaatgctgatcttgactgtagtttttttatatcagaatggagctgtttatatgactttatctacataattccctctctataaatgatattactttttatggagtttggactgctggtactgtgagttaaaacacatcttctgcaatgttttaattgcttcatggggatgcaaagaaagaatacaaatctaggtctatgggaaaaatggtttctaccaaatgttaatgcacacaaatacagatgacggtaagatatgagaagtagtgctaagactgggattaatgtggtggaattagtttttgacatcttaactattttgttaattagaaaagttggatatgtgtatacctttattaaatataggtgttatgcatataaaaaaaaaaaaaaaaaaaaa
Translation: MATSCEDVSPVKSPAVTPLKIRELINEGIVTGERSSIGRKETAVVPEENNGFEDPLSNSSYESTSKDAFFGRVESFSSLKWAGKPSELCPLICAKYGWSNIECDMLKCSSCNAYLCASLQPVLDFSKYKQRCVELQEALRKAHEKFCFWPDSPCPDYFWALMVTEPSSVLSDFVGRFDNLCHLEIQLPSIKHEDLKNMDITEETVSHLLRLIEDELKSKDGREDNSRLASDSLQVHISACILALCGWSTSYTSGSLCIINCPRCMRKVGLWAFQQLEAVELDNSLSAPNTPVSPAEGHERSPFGIMSPNRRVTRSRDAEQSPALAYGRTRSSDLLSPADSEAVRSRPVTRSMGQGESSGLSNELHSSPLRRSKRPRLCSSSSSDTSPRGCFDPLSQHRSWCPWVNVCQASETSTLGSEIQEEASRKEYGWKEVLNVLLAEENSRTLSDPDTSSVPEKSHKVFRIFRQWQMAASASENP
Donor tissue: tailbud