ORFeome > luc7l – XORFeome 2.0

luc7l – XORFeome 2.0

General Information

Species: Xenopus tropicalis LUC7-like (S. cerevisiae), mRNA (cDNA clone MGC:69523 IMAGE:5336520), complete cds
Gene Symbol: luc7l
Gene ID: 448056
ORF gb_acc: MG133368
ORF ID: 10873

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074578

Library Location

Plate ID: GDExt11009
Well Location: G04

EST Sequences

Clone: MGC:69523 IMAGE:5336520
Trimmed Sequence: ATGTCGGCCCAGGCCCAAATGAGAGCTCTGTTAGACCAACTGATGGGCACAGCTCGGGACGGGGATGAGACACGGCAGAGAGTAAAGTTTACAGATGATCGTGTCTGCAAAAGTCATCTCTTGGACTGCTGTCCTCATGATATTCTTGCAGGAACGCGCATGGATCTGGGAGAATGTACAAAGATTCATGATTTGGCACTGAGAGCAGATTATGAAATTGCCAGCAAAGAAAGAGACTTATTTTTTGAGCTTGATGCAATGGATCATCTTGAGTCATTTATTGCAGAGTGCGACAGAAGAACAGAACTTGCTAAAAAACGTTTAGCTGAGACCCAGGAGGAAATTAGTGCAGAAGTGTCTGCAAAGGCAGAAAAGGTTCATGAGCTGAATGAAGAAATAGGAAAACTTCTAGCAAAAGCCGAACAGCTGGGAGCTGAAGGGAATGTAGACGAAGCTCAAAAAATCCTTATGGAGATGGAAAAAGTGAAAGGCAGAAAAAGAGAAGCAGAGGAAGAGTACCGTAACTCAATGCCAGCATCAAGTTTCCAGCAGCAGAAATTACGAGTGTGTGAAGTCTGTTCTGCCTACCTTGGTCTCCATGACAATGACCGTCGACTTGCTGATCATTTTGGAGGCAAATTGCATTTAGGGTTTATTTTGATTCGTGAAAAACTGGAAATGCTGAGGAGAACAGTTGCAGAAAAGCAGGAGAAACGGAACCAAGATCGATTAAGGAGAAGAGAAGAAAGAGAAAGAGATGACCGATTGGGCAGACGGTCGAAATCCAAAAGCAGAGATCGCCGAAGGTCACGCTCCAAGGAAAGGAGAAGACGACGGTCACGATCCTCATCCCGTGATAGAAGAAGATCTCGATCAAGGTCAAGGGACCGACATAGGCGCCATCGCAGTCGATCAGGAAGTCGCAACAGAAGTCATCACCGTAGTTCGAGGGACAGAGGATCAAAGCACAAGTAA
Full Trace Sequence: ggctgcgggacttaacacgcagtcaggccggaaacggaatagaattccgcgttgactatgtcggcccaggcccaaatgagagctctgttagaccaactgatgggcacagctcgggacggggatgagacacggcagagagtaaagtttacagatgatcgtgtctgcaaaagtcatctcttggactgctgtcctcatgatattcttgcaggaacgcgcatggatctgggagaatgtacaaagattcatgatttggcactgagagcagattatgaaattgccagcaaagaaagagacttattttttgagcttgatgcaatggatcatcttgagtcatttattgcagagtgcgacagaagaacagaacttgctaaaaaacgtttagctgagacccaggaggaaattagtgcagaagtgtctgcaaaggcagaaaaggttcatgagctgaatgaagaaataggaaaacttctagcaaaagccgaacagctgggagctgaagggaatgtagacgaagctcaaaaaatccttatggagatggaaaaagtgaaaggcagaaaaagagaagcagaggaagagtaccgtaactcaatgccagcatcaagtttccagcagcagaaattacgagtgtgtgaagtctgttctgcctaccttggtctccatgacaatgaccgtcgacttgctgatcattttggaggcaaattgcatttagggtttattttgattcgtgaaaaactggaaatgctgaggagaacagttgcagaaaagcaggagaaacggaaccaagatcgattaaggagaagagaagaaagagaaagagatgaccgattgggcagacggtcgaaatccaaaagcagagatcgccgaaggtcacgctccaaggaaaggagaagacgacggtcacgatcctcatcccgtgatagaagaagatctcgatcaaggtcaagggaccgacataggcgccatcgcagtcgatcaggaagtcgcaacagaagtcatcaccgtagttcgagggacagaggatcaaagcacaagtaacacctgtttaaggaaacggcaacaacaaaattggcagtatctaaacttacaagaaccttttagatgagcagggaatacacaaggaccattatggagacatccaagatccaatgactttccagatggtggagcttgaagtattacacataacatagtttgtgttgcgtttgtaaataattaagcaatgttctacagattacaatttacggtttttacttaccggaaattcatctttttttaaacttaaatttttattgtttgagctgtgtttgctaaatagtatgctgcttgccctacattttgaaagtagtgaagtataaataaagtattcaatttgtgaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSAQAQMRALLDQLMGTARDGDETRQRVKFTDDRVCKSHLLDCCPHDILAGTRMDLGECTKIHDLALRADYEIASKERDLFFELDAMDHLESFIAECDRRTELAKKRLAETQEEISAEVSAKAEKVHELNEEIGKLLAKAEQLGAEGNVDEAQKILMEMEKVKGRKREAEEEYRNSMPASSFQQQKLRVCEVCSAYLGLHDNDRRLADHFGGKLHLGFILIREKLEMLRRTVAEKQEKRNQDRLRRREERERDDRLGRRSKSKSRDRRRSRSKERRRRRSRSSSRDRRRSRSRSRDRHRRHRSRSGSRNRSHHRSSRDRGSKHK
Donor tissue: tailbud