ORFeome > lzts2 – XORFeome 2.0

lzts2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis leucine zipper, putative tumor suppressor 2, mRNA (cDNA clone MGC:89253 IMAGE:6976252), complete cds
Gene Symbol: lzts2
Gene ID: 448373
ORF gb_acc: MG133819
ORF ID: 11393

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075457

Library Location

Plate ID: GDExt11013
Well Location: G07

EST Sequences

Clone: MGC:89253 IMAGE:6976252
Trimmed Sequence: ATGGCTGCCTTGCAAGCTCTTCCATTATCCATTGACCAAAACGCTGAGGTCAGTGGTAGCCAAAGCCATACAAACACCAGGTCGCCTGTCACAGAGAACACCATGGGAAGCGTCAGCAGCTTAATCTCTGGGAGGACATACCATGACAAGCAGTGCAAGGCCTCCGAATTGAGCAACAAGTGCCGCAAACCTACCAACATGCCAAACTGTTTTAAGCAGCAAGAGGGGCTTATAAAAAGTAATTACAGCTCACAAGATCCTCTGTTTAATGGGCTTCCTACAAAGAAACCCTCTACTACTACCTCTGGAAATAATGGGAATTATGTCTACGTCAACGAGGACTTTAAAGAGGAATGGCATGAACCTAGAGTACCAATCAGCCCCTCTAGTGATGCTGAAGATATTCGGGAAGAGAGAGCTCTTAATGGGAATATAAGAGGGCCTCCCCCCAAACTCATCCCAGTCTCTGGCAAATTAGAAAAGAACGTAGAAAAGACTCTAATAAAACCTACAGCTTTCAAACCAGTAGTGCCGAAGAAACGTAACTCCTCCCTTCAGTACCTTGTGCAACGCAATGGAGGGCCGGGCCTCTCGGAAAGCCAGAGCAGCCTAAATCTTCTCTTCAATGGGAACGCCGCTGGGATCCCAGAAAAGCACAACTTGTTGAGCTGTAGGAACAGCACGCATTCTGGCACCATGTCAGACTCGGGCCGCACTTCCTTGTCGAGCCTTCCCACCTACAGCACGAACTGCAGTCACCAGATGGACCCGGTCAGTGTTTCTATGGGTCACATTAATCTGGATAATCACACGAACATTAATGGATATTCTGATCGAGCACCCAGGGGTCGGACTCGTCCTACGAACTCAGACAGTGGGCGCTCTTCATCTAGCAAGAGCACCGGGTCACTAAGTGGCAGGGGGAACCCGTCCTCTGACAGCGGCTCCTGTGACCGCTCCCCCATCTTGAGCGATGAGATTCTGATTAGAGAGCTGGAAGAAAAGCTTAAGGACAGGGAGATGGAGCTTCAGCAACTCAAAGAAAATCTGGATGAAAATGAAGCTGCGATCTGCCAGGTATACGAGGAAAAGCAGAAGCGGTGTGAGCAGGAGATGGAGGAGTTGCGGCAGAGTTGCGCCCTGAAAATGAAGCAGGCGGCCCAAAAGGCTCAGCGGCTCCAGCAGGTTCTTCAGCTACAGATATTCCAACTGCAGCAGGAAAAGAAAAAACTGCAAGAGGACTTCTCCCAGTTACTGCAGGAAAGGGAGCTGCTAGAGAAGCGATGTGCCTCATTTGAGAGGGAACAGACTGAGTTTGGGCCACGCCTAGAGGAGACCAAGTGGGAGGTTTGCCAGAAATCTGGTGAAATATCATTGCTGAAGCAACAGTTGAAGGACTCCCAGGCTGAGCTGGCACAGAAATCCAATGAGATACTGCTGCTTCGGGCTCAGGTGCGAGAGGCTCGATCCGACCTCCAGATCAGTGAAGAGCAGGTACAGGAGCTGCAGGACACGGCGCACACCAAGACACTGGAGCTGGAGGTGTGCGAGAATGAACTCCAACGCAAAAAGAATGAGGCAGAGTTGCTGCGGGAGAAAGCCAGCAAGTTAGACCAGGAAGTAGCCGGCCTAAGGGAAGCAGCAGTAGCCAACCTGCGCCATGGACTATGCCTTTGCCATGAAAAGGAGGACCCTTTCTTATTATATGAAAGTGACGAGGCCAAAGCGCAGCGGCAGAACGCAGACAACCTGCAGGGCTTGCAGCAGTATGTGGAGCGTCTCAGGGAAGCCCTAACAAGCGAACGCAGGAGATATCAGGAGCAAGCTGACAGCTTTGAAGATGAGCGGCGAATATGGCAAGAGGAAAAAGAGAAGGTGATCCGTTATCAAAAACAGCTGCAGCATAACTATATCCAGATGTACCAGCAGAACCGCGAGCTGGAGAGGGACATTAAGCAGCTCTCCTTAGAACTGGAGGCAAGAGAACTGGACGAGTTTGACTTGCACGGGGCCGAAATCCAGTTTGAGGAAATCACAGCTACAGAAATCTGA
Full Trace Sequence: gggaggcagccgtggctttgtaagggcagtcgagagagggtttatgtgtctgcagaaagagaagcagctgctaatcactgcgcagccgaaagcattccgctcctctgctcacttggggaacttgtgcgcattgtgcaggatggatggacccagggaaggtggtttatgcagtcctctgtatttagattatctacactatggctgccttgcaagctcttccattatccattgaccaaaacgctgaggtcagtggtagccaaagccatacaaacaccaggtcgcctgtcacagagaacaccatgggaagcgtcagcagcttaatctctgggaggacataccatgacaagcagtgcaaggcctccgaattgagcaacaagtgccgcaaacctaccaacatgccaaactgttttaagcagcaagaggggcttataaaaagtaattacagctcacaagatcctctgtttaatgggcttcctacaaagaaaccctctactactacctctggaaataatgggaattatgtctacgtcaacgaggactttaaagaggaatggcatgaacctagagtaccaatcagcccctctagtgatgctgaagatattcgggaagagagagctcttaatgggaatataagagggcctccccccaaactcatcccagtctctggcaaattagaaaagaacgtagaaaagactctaataaaacctacagctttcaaaccagtagtgccgaagaaacgtaactcctcccttcagtaccttgtgcaacgcaatggagggccgggcctctcggaaagccagagcagcctaaatcttctcttcaatgggaacgccgctgggatcccagaaaagcacaacttgttgagctgtaggaacagcacgcattctggcaccatgtcagactcgggccgcacttccttgtcgagccttcccacctacagcacgaactgcagtcaccagatggacccggtcagtgtttctatgggtcacattaatctggataatcacacgaacattaatggatattctgatcgagcacccaggggtcggactcgtcctacgaactcagacagtgggcgctcttcatctagcaagagcaccgggtcactaagtggcagggggaacccgtcctctgacagcggctcctgtgaccgctcccccatcttgagcgatgagattctgattagagagctggaagaaaagcttaaggacagggagatggagcttcagcaactcaaagaaaatctggatgaaaatgaagctgcgatctgccaggtatacgaggaaaagcagaagcggtgtgagcaggagatggaggagttgcggcagagttgcgccctgaaaatgaagcaggcggcccaaaaggctcagcggctccagcaggttcttcagctacagatattccaactgcagcaggaaaagaaaaaactgcaagaggacttctcccagttactgcaggaaagggagctgctagagaagcgatgtgcctcatttgagagggaacagactgagtttgggccacgcctagaggagaccaagtgggaggtttgccagaaatctggtgaaatatcattgctgaagcaacagttgaaggactcccaggctgagctggcacagaaatccaatgagatactgctgcttcgggctcaggtgcgagaggctcgatccgacctccagatcagtgaagagcaggtacaggagctgcaggacacggcgcacaccaagacactggagctggaggtgtgcgagaatgaactccaacgcaaaaagaatgaggcagagttgctgcgggagaaagccagcaagttagaccaggaagtagccggcctaagggaagcagcagtagccaacctgcgccatggactatgcctttgccatgaaaaggaggaccctttcttattatatgaaagtgacgaggccaaagcgcagcggcagaacgcagacaacctgcagggcttgcagcagtatgtggagcgtctcagggaagccctaacaagcgaacgcaggagatatcaggagcaagctgacagctttgaagatgagcggcgaatatggcaagaggaaaaagagaaggtgatccgttatcaaaaacagctgcagcataactatatccagatgtaccagcagaaccgcgagctggagagggacattaagcagctctccttagaactggaggcaagagaactggacgagtttgacttgcacggggccgaaatccagtttgaggaaatcacagctacagaaatctgaagccagtgaatatgcagagctaccacaaatgcctttatacacgccgacaacattccagccaatggctttgccaaaacacagctactaaacactcacacaagctcttcttcattgtcactcagacttacagtggataaaccatactcagtgttttgacagggaaccataggtttatggactgcacattaacactacatgcaacgagatttctaattggcagatcttgaacactgatacaaagtatagtattaaggagccatatgtatatatatatatatatactgtatacctgctcactagttatactatatggaccaaaggaagttgtgtcattgaataagaaatgtatgatactatgtacagcacttatgtatgtgtttgcataaaaacctgctcccttgtcatggcgtgtaacagaatttgaggtactgtcatggagcacaaaggtgccattatgtttagtctgttcagtacttttcagtattcctttctactttctttgtgtagtacagttgttcaggaaagacagaaagtggagcaacgtgactttatatttatgggcccctcaacacccataatgatctgttccacatacacacgttgaaccttttcattagctcccagtgcctccccccctgctaacacagctaggtccccccctccttaaaggattactagcattatttattatctgattaatctcatttaaagttacctgaattcaaaataactaaaacagtattttcaacaacaaaaatttttttttcaaagacctacctgttaagccttattacctgggccagctcaaatacagcctgtctatgacatcactgttcaggctgcattcattggtcaaagctgttgctccgcccacttcccaatttctttgtgaagagatatagtttccagcatagacatgcaccgaaattcagggcagtcatgtgatgtctggttcatttcagtctaggttatttgaaaactgaagctaagaagttgtgtcttaatgataaatcatctttgtatattcccagccagtacatgataatgtgtggcattcagtagcagcaaagggaagccatcagcttttctttatatctcctggaaagtgcccagtatgtgtaagggaagccccacatgccatttgaaataacacgagttctggcagaatatgcaaaccggtgtgtgtgtttgtatgaaatgtagtattatatcaatatgtgtgtgtaattgttagattgctctgtagggggcagtgtgtatgatagctatgcattttctccttaaggcgtaatcacacagcttgaggaacaaggctttacatgttgtgttcatttctatgttttggatgatatgaaatacgaatacattttaatatggctgtacataatgtaaaatataagatcttattttcttcttccccaaagcaatacctttgtttttgtacatactctgagtagcacctttctatgcttcccttggcattctatatgaggatagtcactttaaattctcaggtagatcttggtagagcacaatcacagcacaagactctggtaacccaatatgcagtaacagactgggtgagtagcttctctgccagccggtagcacgttacatggcccagagatgcgctctctcctctctggacaaacggattaaagccaatttgctttccccatatctactttctatgggagtttgtttgtgagcctaataaaaccttgctgtttccagtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAALQALPLSIDQNAEVSGSQSHTNTRSPVTENTMGSVSSLISGRTYHDKQCKASELSNKCRKPTNMPNCFKQQEGLIKSNYSSQDPLFNGLPTKKPSTTTSGNNGNYVYVNEDFKEEWHEPRVPISPSSDAEDIREERALNGNIRGPPPKLIPVSGKLEKNVEKTLIKPTAFKPVVPKKRNSSLQYLVQRNGGPGLSESQSSLNLLFNGNAAGIPEKHNLLSCRNSTHSGTMSDSGRTSLSSLPTYSTNCSHQMDPVSVSMGHINLDNHTNINGYSDRAPRGRTRPTNSDSGRSSSSKSTGSLSGRGNPSSDSGSCDRSPILSDEILIRELEEKLKDREMELQQLKENLDENEAAICQVYEEKQKRCEQEMEELRQSCALKMKQAAQKAQRLQQVLQLQIFQLQQEKKKLQEDFSQLLQERELLEKRCASFEREQTEFGPRLEETKWEVCQKSGEISLLKQQLKDSQAELAQKSNEILLLRAQVREARSDLQISEEQVQELQDTAHTKTLELEVCENELQRKKNEAELLREKASKLDQEVAGLREAAVANLRHGLCLCHEKEDPFLLYESDEAKAQRQNADNLQGLQQYVERLREALTSERRRYQEQADSFEDERRIWQEEKEKVIRYQKQLQHNYIQMYQQNRELERDIKQLSLELEARELDEFDLHGAEIQFEEITATEI
Donor tissue: tailbud