ORFeome > man2a2 – XORFeome 2.0

man2a2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis mannosidase, alpha, class 2A, member 2, mRNA (cDNA clone MGC:89555 IMAGE:6993701), complete cds
Gene Symbol: man2a2
Gene ID: 448465
ORF gb_acc: MG133928
ORF ID: 11521

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075578

Library Location

Plate ID: GDExt11015
Well Location: G02

EST Sequences

Clone: MGC:89555 IMAGE:6993701
Trimmed Sequence: ATGAAACTGAAGAAGCAGGTGACTGTTTGTGGAGCAGCCATCTTTTGTGTGGCTGTCTTCTCCTTGTATCTCATGCTGGACAAAGTGCAACACGACCCACCCAGGAGACAGAACGGTGGCAACTTTCCCAGGAGCCAGATATCTGTCCTACAGAATCGTATAGAGCAGCTTGAGCAGCTCCTAGAGGAAAACCACGAAATCATCAGCCACATCAAGGACTCTGTTCTAGAACTGACAGCCAATGCTGAGGGCCAGCCCATTCTGCTCCCATACCACACTCCTAATGGAACTTGGGTCATGCCACCTGACCCCAGACCTAGCTTCTACTCTGTATCTCCTCAGGACTGTCAGTTTTCTGTGGCAAATAAACGGCAAAAGACAGATTTGCAGATGCTTGATGTTTATACGCAGTTGCCTTTTGATAACGTTGATGGAGGTGTTTGGAAACAAGGCTTTGATATTACTTATGACCCTAAGGAGTGGGACAATGAACCATTGCAGGTGTTTGTGGTTCCACATTCGCACAATGACCCTGGTTGGATCAAAACCTTTGATAAGTATTACTATGACCAGACGCAGCATATCCTCAACAACATGGTAGTGAAATTGCATGAAGATCCACGGCGAAAGTTTATTTGGTCTGAAATCTCTTTCTTCTCTAAGTGGTGGGACAACATCAACTCTCAGAAGCGAGCCGCAGTGCGCAGGTTAGTTGCTAGTGGCCAGTTGGAGATGACAACTGGAGGTTGGGTGATGCCAGATGAAGCCAACACTCATTACTTTGCTATGATTGATCAGATGATAGAGGGACATCAGTGGCTCAAGAAAAACCTTGATGCCACCCCAAGGTCAGGCTGGGCAGTGGACCCCTTTGGGCACAGCTCTACTATGCCATATATCCTAAGACGCTCCAACCTAACCAGCATGCTGATCCAGAGGGTACACTATTCTATCAAGAAGCACTTTGCTGCTACACAGAGTCTGGAGTTCATGTGGAGACAGACATGGGATCCAGATTCCAGCACTGATATCTTCTGCCACATGATGCCCTTCTACAGTTATGATGTCCCACACACATGTGGCCCGGACCCCAAGATTTGCTGCCAGTTTGATTTTAGACGTCTTCCAGGAGGAAGAATAAATTGTCCTTGGAAAGTGCCACCAAGAGCGATCACAGACTCCAATGTGGCTGAAAGGGCCAACATTCTCCTGGATCAGTACAAAAAGAAATCCAAGCTATATCGCAGTAAAGTGGTGCTGGTGCCTTTGGGAGATGACTTTCGCTATGATAAAATCCAAGAGTGGGATGCTCAGTTCCTCAACTACCAAAAGTTGTTTGACTATATGAACTCGCACCCAGAACTCCATGTTCAGGCTCAATTTGGAACACTATCAGATTACTTTGATGCCCTGTACAAGAGGATGGGGGTCGTACCTGGAATTAAACCTCCTGATTTTCCTGTGGTCAGTGGAGACTTTTTCTCTTATGCTGATCGTGAAGATCACTACTGGACCGGATATTACACATCCAGACCCTTTTATAAGAGCATGGACAGAGTGCTTGAGTCCCACCTCAGAGGAGCAGAGATTTTATACAGCTTGGCTATTAATCATGCCAGGAAAGCCGGAACGGAAAGCAAATACCCACTCTCTGATTATGCTTTGTTAACGGATGCCAGACGTAACCTTGGGTTATTTCAGCACCATGATGCTATCACAGGCACAGCAAAGGAAGCTGTGGTGATTGACTACGGTGTACGGTTACTCCATTCGTTGATGAACTTGAAACGCATAATTATTAATGCAGCTCACTACCTCGTTGTGGCAGACAAGGAGAAGTATCACTATGATCATTCTGTGCCATTCTTCAGCACGGATGAGAGCCGTTTAACCCAGGAAAGCCTGCCAGAGAAAACTGTTATTAAGCTGACTGCATCGCCAAGGTACGTGGTGGTTTTTAACCCAGTGGAACAGAACCGCCTGTGTGTAGTCTCTCTGCTTGTGAACACTTACAATGTGCGAGTGCTTACAGAAGATGGCCAGCCTGTGGCAGCCCAACTCAGCCCTGTTTGGCAGTCTGTTACAGACATGAACCCTGATGTCTACCAGGTATCCTTCACTGCCCGGTTACCATCACTTGGGCTCAGTATCTTCCAGCTGCACGCATCCATCGACACCCACACTACACTAAAGTCAAATGTTCGTGTGCATCTGCATGGGCGAGAACTCTCAATAAAGAAACAGGATGTGTTCCCAGTTAAGGTCGCAGAGTCCAGCACGGATGATTTTCATATTGAGAATCAGTACATGCAGGTGTGGTTCTCTGGCACTACTGGTCTCTTAAAGAGCATTAAAAGAGCTGGAGAAGAGCAGGAACAGAAAATCAACATGCAATTCCTCATCTATGGAACTCGAACATCAAAGGATAAAAGTGGGGCCTATCTTTTCCTACCCGATGGTGAAGCAAAGCCCTACACTCCTAAAGACCCCCCTGTGGTTAAAGTGACAGAAGGCCCGTTCTATTCTGAAGTGACTTGCCAATATCAGCATGTGCAGCAAGTTATGAGGCTCTACAATTTACCAGGTACAGAGGGACTGTCTTTAGACATCAGTTCATTGATTGATATCCGAGACCATGTCAACAAGGAGATAGCAATGCGGCTCAGCACTGATATACAGAGTGAAGACATCTTCTTCACAGACTTAAACGGCTTTCAGGTTAATGTCTAA
Full Trace Sequence: gccgagaagctggataataacggggttgcgggacgtgtaagcagcgatcaaggattgcgggctgcgttaagaatatcgggattgtcccgcgaaaggcgggagtgttgagcggtcggctccgtcggctcccaggaatgaaactgaagaagcaggtgactgtttgtggagcagccatcttttgtgtggctgtcttctccttgtatctcatgctggacaaagtgcaacacgacccacccaggagacagaacggtggcaactttcccaggagccagatatctgtcctacagaatcgtatagagcagcttgagcagctcctagaggaaaaccacgaaatcatcagccacatcaaggactctgttctagaactgacagccaatgctgagggccagcccattctgctcccataccacactcctaatggaacttgggtcatgccacctgaccccagacctagcttctactctgtatctcctcaggactgtcagttttctgtggcaaataaacggcaaaagacagatttgcagatgcttgatgtttatacgcagttgccttttgataacgttgatggaggtgtttggaaacaaggctttgatattacttatgaccctaaggagtgggacaatgaaccattgcaggtgtttgtggttccacattcgcacaatgaccctggttggatcaaaacctttgataagtattactatgaccagacgcagcatatcctcaacaacatggtagtgaaattgcatgaagatccacggcgaaagtttatttggtctgaaatctctttcttctctaagtggtgggacaacatcaactctcagaagcgagccgcagtgcgcaggttagttgctagtggccagttggagatgacaactggaggttgggtgatgccagatgaagccaacactcattactttgctatgattgatcagatgatagagggacatcagtggctcaagaaaaaccttgatgccaccccaaggtcaggctgggcagtggacccctttgggcacagctctactatgccatatatcctaagacgctccaacctaaccagcatgctgatccagagggtacactattctatcaagaagcactttgctgctacacagagtctggagttcatgtggagacagacatgggatccagattccagcactgatatcttctgccacatgatgcccttctacagttatgatgtcccacacacatgtggcccggaccccaagatttgctgccagtttgattttagacgtcttccaggaggaagaataaattgtccttggaaagtgccaccaagagcgatcacagactccaatgtggctgaaagggccaacattctcctggatcagtacaaaaagaaatccaagctatatcgcagtaaagtggtgctggtgcctttgggagatgactttcgctatgataaaatccaagagtgggatgctcagttcctcaactaccaaaagttgtttgactatatgaactcgcacccagaactccatgttcaggctcaatttggaacactatcagattactttgatgccctgtacaagaggatgggggtcgtacctggaattaaacctcctgattttcctgtggtcagtggagactttttctcttatgctgatcgtgaagatcactactggaccggatattacacatccagacccttttataagagcatggacagagtgcttgagtcccacctcagaggagcagagattttatacagcttggctattaatcatgccaggaaagccggaacggaaagcaaatacccactctctgattatgctttgttaacggatgccagacgtaaccttgggttatttcagcaccatgatgctatcacaggcacagcaaaggaagctgtggtgattgactacggtgtacggttactccattcgttgatgaacttgaaacgcataattattaatgcagctcactacctcgttgtggcagacaaggagaagtatcactatgatcattctgtgccattcttcagcacggatgagagccgtttaacccaggaaagcctgccagagaaaactgttattaagctgactgcatcgccaaggtacgtggtggtttttaacccagtggaacagaaccgcctgtgtgtagtctctctgcttgtgaacacttacaatgtgcgagtgcttacagaagatggccagcctgtggcagcccaactcagccctgtttggcagtctgttacagacatgaaccctgatgtctaccaggtatccttcactgcccggttaccatcacttgggctcagtatcttccagctgcacgcatccatcgacacccacactacactaaagtcaaatgttcgtgtgcatctgcatgggcgagaactctcaataaagaaacaggatgtgttcccagttaaggtcgcagagtccagcacggatgattttcatattgagaatcagtacatgcaggtgtggttctctggcactactggtctcttaaagagcattaaaagagctggagaagagcaggaacagaaaatcaacatgcaattcctcatctatggaactcgaacatcaaaggataaaagtggggcctatcttttcctacccgatggtgaagcaaagccctacactcctaaagacccccctgtggttaaagtgacagaaggcccgttctattctgaagtgacttgccaatatcagcatgtgcagcaagttatgaggctctacaatttaccaggtacagagggactgtctttagacatcagttcattgattgatatccgagaccatgtcaacaaggagatagcaatgcggctcagcactgatatacagagtgaagacatcttcttcacagacttaaacggctttcaggttaatgtctaaatttgattttgtcaaacaagccccatacacggaagtagaagtagtaattactgtgtatcaaacatattacctctcacccatatagtggaaattctgggatcccacctacaaagtatggatcgggatgaagaatcttctatgcttatactttctaattatggaagttagggcaatttacattacattttagtatgatttagatgatattctgagactgtttgcaactgatctttgtttttatggtttttcagttatttagctttttgttcagattttttggtatttcaaaaactcccattcacaatgtggggcagggtagtagcactaggaagtgttgtgaaaaatgtattccagacaataaacccattttaattcccttcctgtgggctaataaaacccctaggatggcctggcaggctctcctactgccctactggctaaggggggcttaacgctccctcatctatacctatacctgtacctgtactgtaccctcctgggtgaaacgaatctgaatccttaaaatcacgtgacttttagttacataaacacggaagttaaaaaattttcactgtacgctctttgcgcagttctcttttggccccttttttgtcctaatttggattcagattcggttttcagtgcatccctagtacagtattctctatgtactgtgtctgtggttgacattacattgtaatccactctgttaaaaaaaatcaaaaaaaaaaaaaaaaa
Translation: MKLKKQVTVCGAAIFCVAVFSLYLMLDKVQHDPPRRQNGGNFPRSQISVLQNRIEQLEQLLEENHEIISHIKDSVLELTANAEGQPILLPYHTPNGTWVMPPDPRPSFYSVSPQDCQFSVANKRQKTDLQMLDVYTQLPFDNVDGGVWKQGFDITYDPKEWDNEPLQVFVVPHSHNDPGWIKTFDKYYYDQTQHILNNMVVKLHEDPRRKFIWSEISFFSKWWDNINSQKRAAVRRLVASGQLEMTTGGWVMPDEANTHYFAMIDQMIEGHQWLKKNLDATPRSGWAVDPFGHSSTMPYILRRSNLTSMLIQRVHYSIKKHFAATQSLEFMWRQTWDPDSSTDIFCHMMPFYSYDVPHTCGPDPKICCQFDFRRLPGGRINCPWKVPPRAITDSNVAERANILLDQYKKKSKLYRSKVVLVPLGDDFRYDKIQEWDAQFLNYQKLFDYMNSHPELHVQAQFGTLSDYFDALYKRMGVVPGIKPPDFPVVSGDFFSYADREDHYWTGYYTSRPFYKSMDRVLESHLRGAEILYSLAINHARKAGTESKYPLSDYALLTDARRNLGLFQHHDAITGTAKEAVVIDYGVRLLHSLMNLKRIIINAAHYLVVADKEKYHYDHSVPFFSTDESRLTQESLPEKTVIKLTASPRYVVVFNPVEQNRLCVVSLLVNTYNVRVLTEDGQPVAAQLSPVWQSVTDMNPDVYQVSFTARLPSLGLSIFQLHASIDTHTTLKSNVRVHLHGRELSIKKQDVFPVKVAESSTDDFHIENQYMQVWFSGTTGLLKSIKRAGEEQEQKINMQFLIYGTRTSKDKSGAYLFLPDGEAKPYTPKDPPVVKVTEGPFYSEVTCQYQHVQQVMRLYNLPGTEGLSLDISSLIDIRDHVNKEIAMRLSTDIQSEDIFFTDLNGFQVNV
Donor tissue: neurula