ORFeome > mcoln1 – XORFeome 2.0

mcoln1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis mucolipin 1, mRNA (cDNA clone MGC:97581 IMAGE:6977130), complete cds
Gene Symbol: mcoln1
Gene ID: 496811
ORF gb_acc: MG134458
ORF ID: 12161

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088503

Library Location

Plate ID: GDExt11021
Well Location: D01

EST Sequences

Clone: MGC:97581 IMAGE:6977130
Trimmed Sequence: ATGGATCCTCTGCGCAGGAGTCGCAGTCTGAGTGATAGCCCCAAGCTGTCGTCTGAGCGCCGGCGCCTCCTATCTCCATCTCCTAACTATGGTACCCGACTGTGTGAGTTTCCCAGCCCTGAGGAGGTACAGCTCCGCCGTCGGCTCAAGTACTTCTTCATGAGTCCATGTGATAAGTTTCGTGCCAAGGGGAGAAAGCCTTACAAACTGGGCCTGCAGTTACTAAAGATCATGTTTGTCACTGTGCAGCTTATCTTGTTTGGGCTCAGCAATCAGATGGTTGTACAGTTTAAGGAGGAGAATACAGAGGCCTTTAAACACCTGTTCCTGAAGGATTATACTGATGATGCTGAAAAAACCTATGCTGTATACACTCAAGAGGATGTCTATGAACACCTTTACTATGCTGTGGAGCAGTACTTCTCACTGTCCAATCAGACGACTGCCCGATATGCGTATACCCGACCTTTCAACCAGTCGGCTCTCTCCGTGTGCCAGCAATATTACCGTAAAGGCCACATTGACCCCGCTAATGACACATTTAATATTGACCCCCAGGTCATCACAAATTGCCTGTTTTTGGATCCTGCAGAGCCAAGCCAAAGCTACAAGAATTTTACTATTAAGTTTCACAAGCTGATCAATCTGACTGTACAGTTCCAGTTAAAGGCTATTAATATACAAACAATAATTAATAATGAGATTCCAGACTGCTACACCTTTACTATCACGATTTTATTTGATAACAAAGCACACAGTGGAAAAGTCAAGATCCAGCTGGACAATGAAGCAAAAATCAAAGAATGCAAAGATCCAAGTGTATATGGCCGAGGTGATAATCACTCTCGCCTGGCCTTTGATGTCTTAGTCATTCTTTCCTGCATTCTGTCTTTTATCCTATGCGCCCGATCCATTGTACGTGGATTACTTCTACAGCATGAATTTGCTCAATTTGTGCACTATCGTCACGGCCTTACCATTTCCCTGTCTGACCGTCTGGAGTTTGTGAATGGCTGGTATCTGCTGCTTATCATCAGTGATGTCCTTACTGTGTCAGGAACAGTCATGAAAATCGGAATTGAGTCTAAGACCTTTGCTAGCTATGATGTGTGCAGCATCCTACTGGGGACATCAACTCTTCTTGTGTGGGTTGGAGTTATCAGATACCTGAGCTTTTTCCAGAAATACAATATCCTCATAGTCACACTACGTGTCGCCCTTCCTAATGTTATCCGTTTCTGTTGCTGTGTGGCGGTGATCTACTTGGGATATTGTTTCTGTGGTTGGATTGTGCTGGGTCCCTATCATGTTAAGTTCCGCACACTCTCAATGGTGTCCGAGTGCCTCTTCTCCCTTATAAATGGCGATGACATGTTTGTCACCTTTTCTGAAATGCAAAATAGCAGCTACTTGGTGTGGGCTTTCAGTCAACTCTACTTATATACCTTTATCAGCCTTTTTATATACATGGTGCTAAGTCTCTTCATTGCCTTAATCACTGGGGCCTATGAAACTATTAAGTGTCAGAATTCAAGTGATTTTAGTGGCAGCAATGACAATGCTCTTTATCAATACATAGCAGAATGCAAAGACAGCCCCAGCTCTGGGAAATTCCGCTCTGCAAACAGCACAAGCTGCTCCATGTTTTGCTGCTGTACTCAACCGACCCATTGTGATGAAGATGTAGCAGTCAACTGA
Full Trace Sequence: tcgcgttatatctggggtattactgcacagcgccagagacaaccgatgagctagcctgccccgctgaatgtggcccgctgagtaacatggatcctctgcgcaggagtcgcagtctgagtgatagccccaagctgtcgtctgagcgccggcgcctcctatctccatctcctaactatggtacccgactgtgtgagtttcccagccctgaggaggtacagctccgccgtcggctcaagtacttcttcatgagtccatgtgataagtttcgtgccaaggggagaaagccttacaaactgggcctgcagttactaaagatcatgtttgtcactgtgcagcttatcttgtttgggctcagcaatcagatggttgtacagtttaaggaggagaatacagaggcctttaaacacctgttcctgaaggattatactgatgatgctgaaaaaacctatgctgtatacactcaagaggatgtctatgaacacctttactatgctgtggagcagtacttctcactgtccaatcagacgactgcccgatatgcgtatacccgacctttcaaccagtcggctctctccgtgtgccagcaatattaccgtaaaggccacattgaccccgctaatgacacatttaatattgacccccaggtcatcacaaattgcctgtttttggatcctgcagagccaagccaaagctacaagaattttactattaagtttcacaagctgatcaatctgactgtacagttccagttaaaggctattaatatacaaacaataattaataatgagattccagactgctacacctttactatcacgattttatttgataacaaagcacacagtggaaaagtcaagatccagctggacaatgaagcaaaaatcaaagaatgcaaagatccaagtgtatatggccgaggtgataatcactctcgcctggcctttgatgtcttagtcattctttcctgcattctgtcttttatcctatgcgcccgatccattgtacgtggattacttctacagcatgaatttgctcaatttgtgcactatcgtcacggccttaccatttccctgtctgaccgtctggagtttgtgaatggctggtatctgctgcttatcatcagtgatgtccttactgtgtcaggaacagtcatgaaaatcggaattgagtctaagacctttgctagctatgatgtgtgcagcatcctactggggacatcaactcttcttgtgtgggttggagttatcagatacctgagctttttccagaaatacaatatcctcatagtcacactacgtgtcgcccttcctaatgttatccgtttctgttgctgtgtggcggtgatctacttgggatattgtttctgtggttggattgtgctgggtccctatcatgttaagttccgcacactctcaatggtgtccgagtgcctcttctcccttataaatggcgatgacatgtttgtcaccttttctgaaatgcaaaatagcagctacttggtgtgggctttcagtcaactctacttatatacctttatcagcctttttatatacatggtgctaagtctcttcattgccttaatcactggggcctatgaaactattaagtgtcagaattcaagtgattttagtggcagcaatgacaatgctctttatcaatacatagcagaatgcaaagacagccccagctctgggaaattccgctctgcaaacagcacaagctgctccatgttttgctgctgtactcaaccgacccattgtgatgaagatgtagcagtcaactgatgtctaccaatctcacattcctcttgaatggggttttgctggattcagggtagtgggtactggtgattttaatgccattttaagagtccagtgaatacatattccgttgcatttaagaatgggtttaaggcgagattgtaattgtttggcccaagattttgaagactttttagtcagggggactggcttactacctttttaagataatatgcaattgtcaggtacaagccatttatttatatcaaagcaatgtgttcccatagcttctttagcacaatcatatgaccgtgggccagtgagagactttcagcccacaaaccaacagtctcttgtggggttgctgctaaatacaggtatccagtatgtatagatttaaaagtatatattttatgtaggttttaattatggggtgtactttttaataaaaggggagtgtatgtatggtagaggatgtgtgaatgcctagtgtaagaggagagcaaaaacaggagtaaaataaatggagagtatagacaaggggtgcatttgactggtatggatggatgaaacttaagttaatgtaggatgaaagtgtgtatctgggagagagctactaactgtactgaggaaagcaagctcccagatgcagtactagtcaccaaggtgatgccacggtgctactgccaattgcaagtgacacttttctggggttttttttgttttttaatttttcatgttgttttttaattattgtcttgtattgaattcagaataaagtgtcacggaccattccatggataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDPLRRSRSLSDSPKLSSERRRLLSPSPNYGTRLCEFPSPEEVQLRRRLKYFFMSPCDKFRAKGRKPYKLGLQLLKIMFVTVQLILFGLSNQMVVQFKEENTEAFKHLFLKDYTDDAEKTYAVYTQEDVYEHLYYAVEQYFSLSNQTTARYAYTRPFNQSALSVCQQYYRKGHIDPANDTFNIDPQVITNCLFLDPAEPSQSYKNFTIKFHKLINLTVQFQLKAINIQTIINNEIPDCYTFTITILFDNKAHSGKVKIQLDNEAKIKECKDPSVYGRGDNHSRLAFDVLVILSCILSFILCARSIVRGLLLQHEFAQFVHYRHGLTISLSDRLEFVNGWYLLLIISDVLTVSGTVMKIGIESKTFASYDVCSILLGTSTLLVWVGVIRYLSFFQKYNILIVTLRVALPNVIRFCCCVAVIYLGYCFCGWIVLGPYHVKFRTLSMVSECLFSLINGDDMFVTFSEMQNSSYLVWAFSQLYLYTFISLFIYMVLSLFIALITGAYETIKCQNSSDFSGSNDNALYQYIAECKDSPSSGKFRSANSTSCSMFCCCTQPTHCDEDVAVN
Donor tissue: tailbud