ORFeome > mesdc1 – XORFeome 2.0

mesdc1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis mesoderm development candidate 1, mRNA (cDNA clone MGC:75847 IMAGE:5382655), complete cds
Gene Symbol: mesdc1
Gene ID: 394582
ORF gb_acc: MG133036
ORF ID: 10431

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061331

Library Location

Plate ID: GDExt11004
Well Location: B07

EST Sequences

Clone: MGC:75847 IMAGE:5382655
Trimmed Sequence: ATGGCTAGCGGCGGCGGCTCCGGCTCAGCCCGGTCTTCTCTAGCTTCCGGAGCAGCAGCCCAGCCTCGCAAGAAGCTGCTGACCATCTGCGAGCAGTGCAAGAACAAGATGCAGCTGGTGGCCGACCTGCTCCTTCTGTCCAGCGAGCCGCGGCCTGTCAGCCCGGAGAGTTCGCTCCAGCTCGGAGAGGCCTTTGAGAAGTGCCGGGACACGGTGATCGCTCGCACCAAGGGCCTGTCCATCCTCACTCACGATGTGCAGAGCCAGCTCAACATGGGCCGCTTCGCTGAGGTGGGCGACACGGTGCAGGAGATGGGCGATCTGGTGGTGTCCCTGATCGAGCTGTCGGCTCACGCCGCGTACCTGGCCGCCGTGGAGGTGCCTGGCTCTCAGGCCGCTCAGCCCGGGCTTGTGGACCGCTACAAAGTGACCCGATGCCGGCACGAAGTGGAGCAGAGCTGTGCCACCCTGCGAAGTGTGCCCCTGGCGGAACTGACCCCGCAGCTGCTGCTGGAAGTCTCCCAGAACCTCTCCAGGAACCTCAAGATTCTGACGGATGCCAGCGTCGCGGCCAGCGACAAGTCCCGGGACAAGTTTGCCAGGGAGCAGTTCAAGCTGGGGGTGAAGTGTATGAGCACCAGTGCCACCGCGCTGCTGGCCTGCGTCAGGGAAGTCAAGACCTCCCCCAGCGACCTGTCGCGCAACCGATGTGCGCTCTTCAGCGGGCCCCTGGTGCAGGCCGTGCATGCCTTGGTGGGCTTTGCCACTGAGCCCCAGTTCCTGGGGAAAGCTGCCATTCTCAACCCAGAGGGCAAAGCTGTGCAGACTGCCATCCTAGGAGGTGCCATGAGTGTGGTGTCTGCCTGTGTGCTCCTGACCCAATGCCTCAGGGATATAACCCAGCACTCTGATAGCAGCAGCAAGATGACTGACTACAAGGACAGGCTAAGGAGCTCCGCCTGTGCCGTCTCTGATGGCTGCAATCTGCTGTCTCAGGCGCTGAGGGAGAGGTCATCGCCCAGGACTCTGCCCCCAGTCAATGCCAATTCTGTGAAATCTCTCTAG
Full Trace Sequence: ggcaagcactgtgctcgggcagcgcccgtaaccctccatgggatgatgcggctgggaagcccccgggataccgctcccactggccaaggcatgagattcttccccgggagagatggctagcggcggcggctccggctcagcccggtcttctctagcttccggagcagcagcccagcctcgcaagaagctgctgaccatctgcgagcagtgcaagaacaagatgcagctggtggccgacctgctccttctgtccagcgagccgcggcctgtcagcccggagagttcgctccagctcggagaggcctttgagaagtgccgggacacggtgatcgctcgcaccaagggcctgtccatcctcactcacgatgtgcagagccagctcaacatgggccgcttcgctgaggtgggcgacacggtgcaggagatgggcgatctggtggtgtccctgatcgagctgtcggctcacgccgcgtacctggccgccgtggaggtgcctggctctcaggccgctcagcccgggcttgtggaccgctacaaagtgacccgatgccggcacgaagtggagcagagctgtgccaccctgcgaagtgtgcccctggcggaactgaccccgcagctgctgctggaagtctcccagaacctctccaggaacctcaagattctgacggatgccagcgtcgcggccagcgacaagtcccgggacaagtttgccagggagcagttcaagctgggggtgaagtgtatgagcaccagtgccaccgcgctgctggcctgcgtcagggaagtcaagacctcccccagcgacctgtcgcgcaaccgatgtgcgctcttcagcgggcccctggtgcaggccgtgcatgccttggtgggctttgccactgagccccagttcctggggaaagctgccattctcaacccagagggcaaagctgtgcagactgccatcctaggaggtgccatgagtgtggtgtctgcctgtgtgctcctgacccaatgcctcagggatataacccagcactctgatagcagcagcaagatgactgactacaaggacaggctaaggagctccgcctgtgccgtctctgatggctgcaatctgctgtctcaggcgctgagggagaggtcatcgcccaggactctgcccccagtcaatgccaattctgtgaaatctctctagactaggggtgcctcttgcccaaactttaccaaagaataagggggtgtagtaaagagcagtggcgcttacaaagggcagtgctaacaaaaaaa
Translation: MASGGGSGSARSSLASGAAAQPRKKLLTICEQCKNKMQLVADLLLLSSEPRPVSPESSLQLGEAFEKCRDTVIARTKGLSILTHDVQSQLNMGRFAEVGDTVQEMGDLVVSLIELSAHAAYLAAVEVPGSQAAQPGLVDRYKVTRCRHEVEQSCATLRSVPLAELTPQLLLEVSQNLSRNLKILTDASVAASDKSRDKFAREQFKLGVKCMSTSATALLACVREVKTSPSDLSRNRCALFSGPLVQAVHALVGFATEPQFLGKAAILNPEGKAVQTAILGGAMSVVSACVLLTQCLRDITQHSDSSSKMTDYKDRLRSSACAVSDGCNLLSQALRERSSPRTLPPVNANSVKSL
Donor tissue: neurula