ORFeome > MGC69226 – XORFeome 2.0

MGC69226 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC69226 protein, mRNA (cDNA clone MGC:69226 IMAGE:5307688), complete cds
Gene Symbol: MGC69226
Gene ID: 448042
ORF gb_acc: MG133231
ORF ID: 10702

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074563

Library Location

Plate ID: GDExt11007
Well Location: C04

EST Sequences

Clone: MGC:69226 IMAGE:5307688
Trimmed Sequence: ATGGGGCTGTCAATGTCCCTGAGTTCCGAGCCCCTGGAAGGGGGCACCGAGGGATACCATGTGCATGGGATCCAGGAGAACTCGCCAGCACAGAGTGCGGGACTTGAACCCTTTTTTGATTTTATTATTGCGATTGGCCACGCGCGACTGAATAAAGAGAACAGCATGTTCAAAGACCTCCTGAAAGCCAATGCGGAGAAGCCCGTGAAGCTGGAGGTGTACAACACAAAGAGCATGAAAGTGCGGGAGGTGGAAGTTACCCCCAGTAACATGTGGGGAGGGCAAGGGCTCCTGGGGGCCAGTGTGCGCTTCTGCAGCTTCCAAGGTGCCAACGAGCATGTGTGGCACGTACTGGATGTGGAGCCCAATTCCCCCGCTGCCCTGGCAGGCCTGCAGTCCCACACGGACTACATAGTTGGGTCGGATCAGATTCTACAGGAGTCTGAGGATTTCTACGCCTTGGTAGAAGCCCATGAAGGGAAACCACTGAAGCTGCTGGTGTACAACACGGAGACCGACTCTTGCCGAGAGGTGTTTGTGACCCCCAATAGTGCCTGGGGCGGGGAAGGAAGCTTGGGATGCGGAATAGGGTACGGATATCTGCACAGGATCCCCTTGAAGCCTGCATCACCAATAAAAAACACAGAGATAACACCCCCTTCCCCTTTAACGCCTAAGGAGGAGCCCTTGGTGCCCCCTACTAACGGATATAGGGAGACTGCCCTTATGGCGGGCGATGGGCAGACTGATGCCACAGAGGAGGCGATCAACTTACCTGGAAGTACGGAGCAGATGGACCTTGGGAACCCAGCAGAAAGCTCTCTTGTTCTTCCCCCGCCGGTCCAGAGAGTCCTGCACCCAGGGGTTCTAGATCCCTCTGCCTTATCGATGCCAGAAATTCCTGACATAAAGCAACTGATTGATATGGCATCACCGGCATCCATGGATCTGGCCGCAGAGCCCGCTGGCACCAAGCAGTTCATTGGTGCGGAGGAGCTGGAGGCTTTTATGGGACAAGTCAGCTTCTCAGAAGGTGCAGCTGTAGATAACTTGGCCAGCCATCCGGCTGAGGATAGCCTGCCCGCCCCGGGCAACCCCTTGCCCCCCCATTGGGGCCTCGAGGAAGTGACATCAGAAATGACTTTTGAAAACGAACAGTCACCTGATGTGAGCGACGCAGCAGCGCCCCCTGAAGGCGACTTAACCCCCCCTGAGCAATTGGTCACACCCATAGAAGAAGCAAAGGAAGAATAA
Full Trace Sequence: gtcagtgccagcgtattcggctgctggggttccggctttacgggctgttctctcgggttgtaggcagcatcaactgcaggctgaggcatggggctgtcaatgtccctgagttccgagcccctggaagggggcaccgagggataccatgtgcatgggatccaggagaactcgccagcacagagtgcgggacttgaacccttttttgattttattattgcgattggccacgcgcgactgaataaagagaacagcatgttcaaagacctcctgaaagccaatgcggagaagcccgtgaagctggaggtgtacaacacaaagagcatgaaagtgcgggaggtggaagttacccccagtaacatgtggggagggcaagggctcctgggggccagtgtgcgcttctgcagcttccaaggtgccaacgagcatgtgtggcacgtactggatgtggagcccaattcccccgctgccctggcaggcctgcagtcccacacggactacatagttgggtcggatcagattctacaggagtctgaggatttctacgccttggtagaagcccatgaagggaaaccactgaagctgctggtgtacaacacggagaccgactcttgccgagaggtgtttgtgacccccaatagtgcctggggcggggaaggaagcttgggatgcggaatagggtacggatatctgcacaggatccccttgaagcctgcatcaccaataaaaaacacagagataacacccccttcccctttaacgcctaaggaggagcccttggtgccccctactaacggatatagggagactgcccttatggcgggcgatgggcagactgatgccacagaggaggcgatcaacttacctggaagtacggagcagatggaccttgggaacccagcagaaagctctcttgttcttcccccgccggtccagagagtcctgcacccaggggttctagatccctctgccttatcgatgccagaaattcctgacataaagcaactgattgatatggcatcaccggcatccatggatctggccgcagagcccgctggcaccaagcagttcattggtgcggaggagctggaggcttttatgggacaagtcagcttctcagaaggtgcagctgtagataacttggccagccatccggctgaggatagcctgcccgccccgggcaaccccttgcccccccattggggcctcgaggaagtgacatcagaaatgacttttgaaaacgaacagtcacctgatgtgagcgacgcagcagcgccccctgaaggcgacttaaccccccctgagcaattggtcacacccatagaagaagcaaaggaagaataaactacagccaatcaatcgcttactccaaatattaactctttccctgccagagtgccctgctcgacgctgtgcctctagcagtgacgcatttgcatttttagcagttttttttttttagatcttcaaataagagcgattaagcttttttttaatacaaagaactttgttttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGLSMSLSSEPLEGGTEGYHVHGIQENSPAQSAGLEPFFDFIIAIGHARLNKENSMFKDLLKANAEKPVKLEVYNTKSMKVREVEVTPSNMWGGQGLLGASVRFCSFQGANEHVWHVLDVEPNSPAALAGLQSHTDYIVGSDQILQESEDFYALVEAHEGKPLKLLVYNTETDSCREVFVTPNSAWGGEGSLGCGIGYGYLHRIPLKPASPIKNTEITPPSPLTPKEEPLVPPTNGYRETALMAGDGQTDATEEAINLPGSTEQMDLGNPAESSLVLPPPVQRVLHPGVLDPSALSMPEIPDIKQLIDMASPASMDLAAEPAGTKQFIGAEELEAFMGQVSFSEGAAVDNLASHPAEDSLPAPGNPLPPHWGLEEVTSEMTFENEQSPDVSDAAAPPEGDLTPPEQLVTPIEEAKEE
Donor tissue: gastrula