ORFeome > MGC69392 – XORFeome 2.0

MGC69392 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC69392 protein, mRNA (cDNA clone MGC:69392 IMAGE:5335334), complete cds
Gene Symbol: MGC69392
Gene ID: 594944
ORF gb_acc: MG134243
ORF ID: 11902

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090585

Library Location

Plate ID: GDExt11019
Well Location: H05

EST Sequences

Clone: MGC:69392 IMAGE:5335334
Trimmed Sequence: ATGGAATTCCCTAAACAGACGGAAATGGTAGATATGGGTCTGAATGGAAAAGGGAGTTTAGGAACAGAAACCCCAGAACCCAGTTTTATCGGAAATGACAATCAAGAGTTGGAGGAGTTCTTGCCGCACGCCGCTGGGAAAGAGAAGCCGCGATTTACAGATTTTGAGGGGAAGACATCCTTTGGAATGTCAGTGTTTAACCTCAGCAATGCAATCATGGGCAGTGGCATCCTGGGACTGGCATATGCTATGGCCAATACTGGCGTCATCCTCTTCCTCTTACTCCTGACTGCTGTGGCACTGCTGTCCAGCTACTCCATCCACCTGCTGCTGAAATCATCGGGAATTGTGGGTATTCGTGCCTATGAGCAGCTTGGATATAAGGCGTTTGGGACTCCAGGAAAGATGGCTGCTGCTATTGCTATAACTCTGCAGAATATTGGAGCTATGTCTAGTTATCTGTACATTGTGAAATCAGAGCTTCCCCTGGTCATTCAGACCTTCCTCAATCTTCCTGAGAAAACCTCAGACTGGTATATGAATGGCAACTATTTGGTAGTCATGGTCTCCATCGCTGTCATCCTACCCCTGGCACTGATGAAGCAGCTGGGGTACCTGGGCTATGCCAGTGGCTTTTCTCTCAGCTGTATGGTGTTCTTTCTATGCTCGGTTATCTATAAAAAGTTCCAGATTCCTTGTCCTCTTGATTGGGACAATGTCAATGGCACAGTGTTAGGGAACCTAAGCCTGGCAGCAGTGGGCCACGCGTATCAGAATGGCCACGTTGAAATCGCAGAAGCTGAGGCAGGCCAGTGTGAACCCAAGATGTTCACATTAAACTCGCAGACGGCATATACAATCCCCATTATGGCCTTTGCCTTTGTGTGCCACCCAGAGGTTCTGCCCATATATACTGAGCTGAAAGACCCCTCCAAGAAGAAGATGCAGCTTGTATCTAATATCTCCATTGCTGTCATGTACTGCATGTATTTCCTAGCTGCTCTCTTTGGATACCTCACCTTCTATAATCATGTTGAATCCGAGCTCCTGCACACATACAGCTATGTGGATCCCTTCGATATCCTGATCCTGTGCGTGCGAGTGGCTGTGCTGACGGCCGTCACACTCACAGTCCCCATAGTGCTGTTTCCGGTGAGACGCGCCATCCAGCACATGCTGTTCCAGGACAAGGAGTTTAGTTGGATCAGACACATCATCATTGCAGTGCTGCTGCTTACTGTGATTAATCTGCTGGTTATTTTTGCCCCAACTATACTTGGCATCTTTGGCATAATTGGTGCTACATCGGCCCCATGCCTCATCTTCATTTTCCCAGCCGTCTTCTATATTCGAATTATGCCTAAAGACAGGGAACCTACAAAATCTACGCCCAAAATATTGGCCGCGTGCTTTGCTGTCCTGGGTATCCTGTTTATGATCATGAGCCTGAGCTTTATCATCACTGACTGGGCAACTGGAAGCAGTAAAAGCGGTGGAAGCCACTAA
Full Trace Sequence: gtgagagaaaggataaagccagaggcagggaatgaagaaaggcagcaagtagtggcaccccgcatcctgccggatcattagagccagtgcccgccttacttacatatctctcccttagccaagtgccgacccgccttcccccagtggcaccacctgtctccctgtgaccgcaccgcgctgaggggcagctccgcctgaggaaccaacacggactcactgaggggaacctgatcccatagcaatggaattccctaaacagacggaaatggtagatatgggtctgaatggaaaagggagtttaggaacagaaaccccagaacccagttttatcggaaatgacaatcaagagttggaggagttcttgccgcacgccgctgggaaagagaagccgcgatttacagattttgaggggaagacatcctttggaatgtcagtgtttaacctcagcaatgcaatcatgggcagtggcatcctgggactggcatatgctatggccaatactggcgtcatcctcttcctcttactcctgactgctgtggcactgctgtccagctactccatccacctgctgctgaaatcatcgggaattgtgggtattcgtgcctatgagcagcttggatataaggcgtttgggactccaggaaagatggctgctgctattgctataactctgcagaatattggagctatgtctagttatctgtacattgtgaaatcagagcttcccctggtcattcagaccttcctcaatcttcctgagaaaacctcagactggtatatgaatggcaactatttggtagtcatggtctccatcgctgtcatcctacccctggcactgatgaagcagctggggtacctgggctatgccagtggcttttctctcagctgtatggtgttctttctatgctcggttatctataaaaagttccagattccttgtcctcttgattgggacaatgtcaatggcacagtgttagggaacctaagcctggcagcagtgggccacgcgtatcagaatggccacgttgaaatcgcagaagctgaggcaggccagtgtgaacccaagatgttcacattaaactcgcagacggcatatacaatccccattatggcctttgcctttgtgtgccacccagaggttctgcccatatatactgagctgaaagacccctccaagaagaagatgcagcttgtatctaatatctccattgctgtcatgtactgcatgtatttcctagctgctctctttggatacctcaccttctataatcatgttgaatccgagctcctgcacacatacagctatgtggatcccttcgatatcctgatcctgtgcgtgcgagtggctgtgctgacggccgtcacactcacagtccccatagtgctgtttccggtgagacgcgccatccagcacatgctgttccaggacaaggagtttagttggatcagacacatcatcattgcagtgctgctgcttactgtgattaatctgctggttatttttgccccaactatacttggcatctttggcataattggtgctacatcggccccatgcctcatcttcattttcccagccgtcttctatattcgaattatgcctaaagacagggaacctacaaaatctacgcccaaaatattggccgcgtgctttgctgtcctgggtatcctgtttatgatcatgagcctgagctttatcatcactgactgggcaactggaagcagtaaaagcggtggaagccactaaccctagaaacatcactatttactccccccattccttccccaacatgggacttcaccctacttggtgatttcactgctggcacatcatagccgtgcttgccatgtgaggacagactgtttttttaatgctcccctggaaggatttgatttctttaggatggggaagtgtgactttttaccccattctcatgctaggacacattgtggtggcattaaggtgtctgctattaactctagatggcaaaatacagagctacatgccccctgctactaagagagggacttcctttcttcctgagtcatcctgtagtattaggggacatcctccatgggtagcaggcacctccattggtatcatttgaactgaacaagcctataccacatttcatctggacaaagatgcaggacaaaggggaaataaatctgtgtcttgtgtgtttatagcatatgttggattaacatggtgcttgaagaaccgagcactttatttccttgctgttaagaggaaactacagcacgagccagtatcacgtatctgtatgcagtctcacaataccatctccgtctttacactcacagagtaacgtgtaaataggcgtttcaaactgaatactctgcataagtattgaatttaagaggaacaaggggattctatagtaggaggtgatcaggagcgtgggaagtaaagagcagttcggtgggatggagcagctgagggagcaacagatttggtctaaagagtggtgtgagaggacagtggcagatatcctggtgggagcaatgagttacatattagtcataggcaagaccaggggcgtccttgggataatattcattcccaaggtttggaggctgcagggctggtaacgtctattttaccagtgggtaggtcacaaagaagctctctgtgaataatatataggtagtgtgtgtggcattgggattctctggcacgtgtgcccatcagaaaaccaaggggatctcaggggttgctgtctataggatggtaaatggacaagtcatactgcatgtattatgtagctcccaatgtaccattatgcagaaagaggagcccagcccaatattggccccttgtgttgtccccttattggacagttatttcttgcagaaatgacaaaaagtgcaaagctggagctgggcagccataaaagcccctggctggatagaacaaaaactccagatatccaaccaagtcacgtctgaagttggtaaaagccacctagaggctttgttgctctctgtgcgcccctctaagctctgctctgtctcgctgggacactctcacacctctcaaatggaattcagctcacttggaaagtatttcctagctaattaatattccgcacaataatggctgagtgtgaggggagatgaagcaggaggctgggtgacagcagggaggaaagagcctttgagaccagagggcaacgtgcaaaacaaagaggcaaaatcccgtaggaaaaaacatcctgtcactggctaattgcccttcgctagccaggatcaaggggcaccagcaggactaaaggaatcattggccccaagaaaagatcctataaatgataaagatgactgtatagaaataaaagtgttggatgggcagagagagggaatcctttacaaatctccgcagctcattaattaaagctgcccatctgacatgggcgagacaggcaacatattgactttctgttgactcgggcgacattggacaccgttaatcttaacataaatcgagcagcctgttatatatgtagggcagttatttggccgggaaaggaagcgtgtataaagggaaaataagcaatgcccatctttctttcatttccttatattgacagaaaggatcaaggggaaatgttactgtaaccatctctgcatgtttgcaatctccagggccatattggctactgcaccagctagggaatactaaacaggcagcaatagaacagcgccaccacctgatcataaccaatgctgcttccatgctgttcttacataaacaagacctattgcctatagcaaacaaaaacctgttgaacaataaactctgcatttatgtattacagcctatttaggggaaagatacattcaaatgttgcctattttccctttgagcccactcaccgtgctcaaacaccctctagcaaaagatccccttgtgaactcaatgtgtttaaatcactaaattattgtcatatttgtacttttgtaacaataaatagaaggttggaacgcgcagccctttccatgctgaagaatggaaccgggcatttatgtgttaggtagatttctagaacataatctgtttttaaattatgttaaaatagttgttttattgggaaacatgaactgtttgatgaaattaatctttgtaagaggtaattaaaaaaaaatcaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEFPKQTEMVDMGLNGKGSLGTETPEPSFIGNDNQELEEFLPHAAGKEKPRFTDFEGKTSFGMSVFNLSNAIMGSGILGLAYAMANTGVILFLLLLTAVALLSSYSIHLLLKSSGIVGIRAYEQLGYKAFGTPGKMAAAIAITLQNIGAMSSYLYIVKSELPLVIQTFLNLPEKTSDWYMNGNYLVVMVSIAVILPLALMKQLGYLGYASGFSLSCMVFFLCSVIYKKFQIPCPLDWDNVNGTVLGNLSLAAVGHAYQNGHVEIAEAEAGQCEPKMFTLNSQTAYTIPIMAFAFVCHPEVLPIYTELKDPSKKKMQLVSNISIAVMYCMYFLAALFGYLTFYNHVESELLHTYSYVDPFDILILCVRVAVLTAVTLTVPIVLFPVRRAIQHMLFQDKEFSWIRHIIIAVLLLTVINLLVIFAPTILGIFGIIGATSAPCLIFIFPAVFYIRIMPKDREPTKSTPKILAACFAVLGILFMIMSLSFIITDWATGSSKSGGSH
Donor tissue: tailbud