ORFeome > MGC75569 – XORFeome 2.0

MGC75569 – XORFeome 2.0

General Information

Species: Xenopus tropicalis myosin light polypeptide 5 regulatory, mRNA (cDNA clone MGC:75569 IMAGE:5379063), complete cds
Gene Symbol: MGC75569
Gene ID: 394873
ORF gb_acc: MG132844
ORF ID: 10196

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063895

Library Location

Plate ID: GDExt11003
Well Location: C01

EST Sequences

Clone: MGC:75569 IMAGE:5379063
Trimmed Sequence: ATGGCTGAGGATGTGAGCAGCGGGGAACAGACAGAGGACCAAGCTGGGCAGCCGCTTCTTAATGGGGAGATAATAGCCTCGAACGGGGATAAGTGCCAATTTCGGACCTACAAGCGAAGATGGTTTGTTCTGGGCGTAATATGCCTGCTGAGCTGTACCAATGCCATGCTGTGGATCAGTTTTGCCCCAGTGGCTGATGTGACGGCAAGTTTCTTCAAGTGTAGCCTTGACGTTGTCAACTATCTGTCTCTTGTGTACCTCATTATTGCAATTCCAGTGGGATTTGGAGCATCGTGGCTGATAGATACTCTTGGACTAAAATATGCTATAGTCTTTAGCTCTTGGCTTAACATGATTGGAAGCATCATACGTTGTGGTGCTATTGTACCTTACCTCAATCCCTCTGGCTCATACACTGGGATATATTACCTTTTTACTGGACAAAGCCTGTGTGCTATAGCACAGCCACTTGTCTTATTTGTACCTGCTAAGCTTGCATCTGTGTGGTTCCCTGAACATCAACGTGCAACAGCTAATATGATCGCCTCTATGTCCAATCCTTTGGGTGTGCTTCTAGCCAATATTATTTCCCCTTCAGTTGTAACCAAAGAGGAGTATATTGCACACATGCTTGGAATCTATACTGTTCCTGCTATAGCTGCTTGCATTCTTGCAACTGCTGGGATTCGTGCGAAATCTCCTCCAACTCCACCATCAGCAAGTGCCTTTAACTCGGCTTCTGAGCCCTTCATAGCCGGTATAAGACAGCTCCTGACAAATAGAGCTTACGTCATCCTAATGCTGTGTTTCGGGGCAGGAATTGGAATATTCACAGCAATTTCTTCTTTTCTGGAGCAGATTTTGTGCTTTAGGGGCTATTCAAATCTTTTTGCAGGTGTGTGTGGAGCCCTGTTTATTTTCTTTGGGTTCATTGGTGCATTTGTTTGTGGACTTTATGTTGACAGGACGAAAAAATTCAAGGAAGTTGTCAAGACCTGCTTTGCATTAACCGCGCTGACAAGTATTGCATTTGCACTGGTGATTAACTTCCGTGAGCAAACAGTTTTGGTGGCGTGCGTATGCTCTTTGTTGGGATTGTTCGGGTTTGCAATCTCTCCAGTTGGAATGGAACTAGCTGTGGAATGTTCCTACCCAGTCGGAGAAGGAAGCTCAACGGGTTTGGCCTTCATCTCTGGGCCATTTGCAACGTCTGGACCTTCTCCCTGCGGAATGAATCAGACTGAAATATATGACTGGTCAACTTCCATGTTAGTGATGGCTGCTTTGTGCAGCTTTGGTTCCTGCATATTTATTATCTTCTTTCATACAAAGTACAAGCGACTCCTTGCAGAAGTGAATTTTAATGGATTAAAAGAAGAATTGAACACACATGAAACATAA
Full Trace Sequence: agccggcatacgttagctaactgtgtgtagcatgccagctgtcccgtgacagactcacttccgtggcgaataagtgggaagacctgtatgttcctggtgtggcaccgggttccttttgccccagggcagtctgtgcgcccggctgcgtgatggctgaggatgtgagcagcggggaacagacagaggaccaagctgggcagccgcttcttaatggggagataatagcctcgaacggggataagtgccaatttcggacctacaagcgaagatggtttgttctgggcgtaatatgcctgctgagctgtaccaatgccatgctgtggatcagttttgccccagtggctgatgtgacggcaagtttcttcaagtgtagccttgacgttgtcaactatctgtctcttgtgtacctcattattgcaattccagtgggatttggagcatcgtggctgatagatactcttggactaaaatatgctatagtctttagctcttggcttaacatgattggaagcatcatacgttgtggtgctattgtaccttacctcaatccctctggctcatacactgggatatattacctttttactggacaaagcctgtgtgctatagcacagccacttgtcttatttgtacctgctaagcttgcatctgtgtggttccctgaacatcaacgtgcaacagctaatatgatcgcctctatgtccaatcctttgggtgtgcttctagccaatattatttccccttcagttgtaaccaaagaggagtatattgcacacatgcttggaatctatactgttcctgctatagctgcttgcattcttgcaactgctgggattcgtgcgaaatctcctccaactccaccatcagcaagtgcctttaactcggcttctgagcccttcatagccggtataagacagctcctgacaaatagagcttacgtcatcctaatgctgtgtttcggggcaggaattggaatattcacagcaatttcttcttttctggagcagattttgtgctttaggggctattcaaatctttttgcaggtgtgtgtggagccctgtttattttctttgggttcattggtgcatttgtttgtggactttatgttgacaggacgaaaaaattcaaggaagttgtcaagacctgctttgcattaaccgcgctgacaagtattgcatttgcactggtgattaacttccgtgagcaaacagttttggtggcgtgcgtatgctctttgttgggattgttcgggtttgcaatctctccagttggaatggaactagctgtggaatgttcctacccagtcggagaaggaagctcaacgggtttggccttcatctctgggccatttgcaacgtctggaccttctccctgcggaatgaatcagactgaaatatatgactggtcaacttccatgttagtgatggctgctttgtgcagctttggttcctgcatatttattatcttctttcatacaaagtacaagcgactccttgcagaagtgaattttaatggattaaaagaagaattgaacacacatgaaacataacatgccaaagccatgctagtgtcataaagccacctcacactggatacctaaggacttgaagactgatttaagtgttgcatatgaaatgctatgaaagaattacaagtattccctcagtaatgaactaccctaaatagcccttccttgagctctatgagttacactgaaggcaaccacatgtactgtatatactattctacatactagaaacttttaaaacttttttgctaattaaaatgttctcttaaaaacgttcttttaattattttttttaattacaaatgttcattgacttgacagttaatcgtaaatgaaaattgtttttgtaatctggcaaactgagaagacagtagaacccagcagacagatacactgcaattgaactgttgctgggtatcagaaccacagtgccttgcttgcctctccttttgtaggcatgataaacgcagcacatgcaaggcattgtgggaactggagtgttggctgacggagagctgactactgacacagtgttgcaatggcacatatagtcatatggactgtgtacatgttcatggcaactgacaagctaattatttgtatttactgaattgtaattaaaatatttttacattcccaaaaaaaaaaaaaaaaaa
Translation: MAEDVSSGEQTEDQAGQPLLNGEIIASNGDKCQFRTYKRRWFVLGVICLLSCTNAMLWISFAPVADVTASFFKCSLDVVNYLSLVYLIIAIPVGFGASWLIDTLGLKYAIVFSSWLNMIGSIIRCGAIVPYLNPSGSYTGIYYLFTGQSLCAIAQPLVLFVPAKLASVWFPEHQRATANMIASMSNPLGVLLANIISPSVVTKEEYIAHMLGIYTVPAIAACILATAGIRAKSPPTPPSASAFNSASEPFIAGIRQLLTNRAYVILMLCFGAGIGIFTAISSFLEQILCFRGYSNLFAGVCGALFIFFGFIGAFVCGLYVDRTKKFKEVVKTCFALTALTSIAFALVINFREQTVLVACVCSLLGLFGFAISPVGMELAVECSYPVGEGSSTGLAFISGPFATSGPSPCGMNQTEIYDWSTSMLVMAALCSFGSCIFIIFFHTKYKRLLAEVNFNGLKEELNTHET
Donor tissue: tailbud